Microarray Probes on PGSC0003DMT400034348

Probe IDChipProbe Sequence
CUST_8668_PI426222305 JHI_St_60k_v1 GAACTTACTGGAACCATTAGAAAAGGACACGGTCAGCCTCAGTACTTAGATAAATTGCAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034348

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034348 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G39900.1 +3 0.0 890 452/555 (81%) Small GTP-binding protein | chr5:15976719-15978925 REVERSE LENGTH=663

Transcript Sequence (2705 bp)

>PGSC0003DMT400034348 2705 pgsc_dm_v3.4
TTTGTATTGGTCTCTCTAATCAAACAAAAAGTGAACCGCAAAGCCCTAATGTAAAACCCT
CAGCTTTGTGGTTCTTCAAACACAAATCGTGGGGAAATGACTACTTTCAAGAGAGCTTCA
AGAGCTCTCACATCCAAATTAGCTGCAATTTATACTTGCAATTTTCATCCGGTAACCTCT
TTATCGCATTTTTCTTATACTCAAAATGCTTCATTTTGCTCTCGTCCTCGCCAAAACAAT
AAAGGATCAACTATAGATTTGAATCAGTACCCTTCTGATAACATTCGTAACTTTTCAATT
ATTGCCCATGTTGATCATGGAAAATCAACCTTAGCTGACAGACTTCTGGAACTTACTGGA
ACCATTAGAAAAGGACACGGTCAGCCTCAGTACTTAGATAAATTGCAGAGAGGGAACGGG
GAATAACTGTTAAAGCCCAAACAGCAACTATGTTCCATCGTCACAAGTTCCTTGGCAGTG
ACACAGATTTTTTGTTGAACCTTATTGACACACCTGGGCATGTGGATTTTAGCTATGAAG
TATCCAGATCTTTGGCAGCTTGTCAAGGTGCCCTTTTGGTTGTTGATGCAGCCCAAGGTG
TGCAGGCACAGACTGTTGCTAATTTTTACCTCGCGTTTGAATCAAACCTGGCCATAATTC
CTGTCATAAATAAAATTGATCAACCCACTGCTGATCCAGATCGGGTAAAAGCACAGCTCA
AATCTATGTTTGACCTTAATCCAAGTGATGTACTATTGACATCAGCAAAAACTGGTCTAG
GTCTAGAGCAGGTTCTTCCTGCTGCAATAGAGAGAATTCCTCCACCCCCTGGAAAAAGCA
CTTCACCTTTGCGAATGCTTTTGCTGGATTCATATTATGATGAGTACAAAGGAGTTATCT
GCCATGTGTCTATTGTTGATGGTGCTCTGCACAAGGGTGACAAGATTTGCTCTGCTGCGA
CTGGCCAAAGTTATGAAGTTTCCGATGTTGGTATCATGCACCCAGAACTTGTGGCGACAG
GAATCCTTTTAACAGGTCAAGTTGGATATATAGTCAGCGGAATGCGTTCAACAAAAGAGG
CCCGTGTTGGAGATACTCTACATCATACACGAACAGTTATACAGCCCCTTCCAGGTTTCA
AGCCAGCAAAACATATGGTCTTTTCTGGCCTATATCCAGCTGATGGATCTGATTTTGAGG
CACTTAACCATGCCATAGAGAGACTGACGTGTAATGATGCCAGCGTCTCTGTAACTAAAG
AAAGCAGCACAGCTCTAGGTCTGGGTTTCAGATGTGGTTTCTTGGGCTTACTTCACATGG
ATGTTTTTCATCAGCGACTTGAGCAGGAACATGGAGCACATGTCATTTCCACTGTTCCTA
CAGTGCCATATATTTTTGAGTACTCAGATGGAAGCAAATTACAGGTTCAGAATCCAGCTG
CTTTGCCTTCAAACCCCAAAAATAGACTCATTGCCTGCTGGGAACCTACTGTGTTAGCTA
CTATTATAATCCCTAGTGAGTATGTGGGGTCTGTTATCACTTTATGCGCTGAGCGTCGCG
GGGAGCAATTGGAGTACTCATTCATTGATAGCCAGCGAGCTTTCATGAAGTATCGCATGC
CTCTGAGGGAAATTGTTGTGGACTTCTACAATGAATTGAAAAGTATAACATCAGGATATG
CTTCGTTTGATTATGAGGATTCAGAATATCAGGCTTCGGATTTGGTGAAGCTGGATATTC
TCCTTAATGGCCAACCAGTTGATGCCATGGCAACCATTGTCCACAAATCAAAAGCTCCAC
GTGTTGGCCGTGAACTTGTGGAGAAGCTTAAAACATTTATAGACAGGCAGATGTTTGAAA
TTATCATACAAGCTGCTATTGGATCTAAGGTCATAGCCCGGGAGACGCTTTCTGCTATGA
GAAAAAATGTTCTGGCAAAGTGTTATGGTGGTGATGTTACAAGAAAGAGGAAGTTGTTGG
AGAAACAGAAAGAAGGGAAGAAGCGAATGAAGCGAGTGGGATCCGTCGATATACCCCAAG
AGGCATTCCACGAGTTACTCAAGGTCTCATGAAGACTATCTTAAATGCCTTCTAGATTTC
TAGATACAAAAGCGTAAGATGTCGTCATATACGATGATGGATACCCACACAGTTGATGTT
GTACAATCACTAAGTTCCATTGCACAAGCTACCTTTGTTAGACGAGTGGATGAAGATAAA
GTTCAACGGGTATGACTATAAAACCCCAATTTTATCCTCATTTTATCCCTGGAGACATAC
AAATGTTTTGTTGTGGTCAAAGTTGACCCCTTTTTTCATGTGTTGGAGGTGGGATAATTT
AAGCCATTGAATAACCCTTTTTGATGACATTATTGTTGGAAGAAAGATCAAATCAGGTCT
CTATTGGTCCATCGTACAACATGGATCTCAGCTGCATACTCTGCAATATTTGAATTCAGA
AGTATACCAAGTGCCATGGTAGAAAATTTTCTTGCTAGAATTGATAGGGACGTGACATTT
CCTTATTCGTATCGTCCAAATCGTTAGAGGGTGGCATAAATTGAGTCCTAATAATGTAGT
TGATTGAATTTGGAACTAGATTATGGAAAACTTGATTGTTAACGTTGCTTGTCGTCCCAG
ATTTTAACCGTATGATGTAACAACTTTGGTTGAAATTGGTAACGGCATTGATTCTTCATT
CCGTC