Microarray Probes on PGSC0003DMT400034108

Probe IDChipProbe Sequence
CUST_51005_PI426222305 JHI_St_60k_v1 TTTACCCTCCCGATAGTTACCCCGAGTCCTAATTGTTGTATTTTCGAAGTTGGTTTGAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034108

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034108 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G20693.1 +1 1e-28 108 51/102 (50%) high mobility group B2 | chr1:7177282-7178487 FORWARD LENGTH=144

Transcript Sequence (744 bp)

>PGSC0003DMT400034108 744 pgsc_dm_v3.4
CTCTGGTTCATCATGAAAGGAGGTAAATCCCATGCCAAAGATGATAGCATGCTTGGCCTG
ACGAAGAAAACTCCGGAGACTAAAGAAGCAAAGAGAGTCTTTATGGAGCTAATAGTATTA
TCAGACTCTGAGGAAGAAAACGCTCACCCACCCCGTGGCTCCAAAGATTGGGGAAATCCA
TGCTATTTACATCCAGGAGGTAAATCCGATGCCAAAGCTGATAACATGCACGGCGTGAAG
AAGAAAGTTGTCGAGACTAAAGAAGTGAAAAAGGCTGCCAAGGATCCTGACAAGCCTAAG
AGCCCAGCAAGCGCTTTCTATGTTAAGCGAGGATGGAGGTCTGACAGGAATCCAAACAAA
CCCAAGAAGCCTGCAGGTGCTTTCTTCATTTTCATGGAGGACTTTAGGAAGCAGTTCAAG
GAGGAGAGTCCAAATAATAAATCTAAGGTCCCTATCCATATAGCTGGTGGAGAGAAGTGG
AAACAGTTGTCAGATGCTGAAAAAGCTCCTTATATGGCAGAGACAAGGAAATGGCTGGCT
GATAACCATAAGAAGAAGGATGCTTATAAGAAGCGAGTAGCTGCTGAAGATTCTGATGAA
GAGGAATCTTACAAGTCACTGTTCGAAGTTGATTAGTGTAATGACCCTAAAGGTCATTTT
TGGAAATTTTCATAAAATGACCGTTTTACCCTCCCGATAGTTACCCCGAGTCCTAATTGT
TGTATTTTCGAAGTTGGTTTGAAG