Microarray Probes on PGSC0003DMT400034089

Probe IDChipProbe Sequence
CUST_19908_PI426222305 JHI_St_60k_v1 GTCAGCAGATCTATCCGTGACTTTAGTTCAATAGGATTTTCTTTTTGTATAGGAACTAGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400034089

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400034089 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G36930.2 +2 6e-100 349 206/528 (39%) Disease resistance protein (TIR-NBS-LRR class) family | chr5:14567771-14571916 REVERSE LENGTH=1191

Transcript Sequence (4561 bp)

>PGSC0003DMT400034089 4561 pgsc_dm_v3.4
CTAATCTGTTTTAAAAATATATTACATGGGTTGACTTGGGGAAGATAAGCGCTGTGCATC
TTCGTTTGAATTTCCGATGGGGTTCTTCTTGTGCAGTGCTTCGCCTGTGCATAATAACCA
TCCAAGAATTCAATTACTTAAGCTTAATCCTGGTTGATAATCGCAGTATCATATACAAAA
CAAGATTAAAGAGCATCTTCATATAGAGCTTTGATCTATATTCATGATGAGAGTTGAAAA
GGCATCAGTCTCCAGGCCTAGATGCTCTTATCATGTCTACTTGAGTTATAGAGGCAAAGA
GATCAGCGTGAACTTTATCAATATCCTACACACTGCATTGACTGATGTTGGTATTCAAAC
ATTCAAGAGACACAGTGAAGCTAGAAAAGGAAAGATTGTTGGATCAGAATTGCAAAAGGC
AGTCAAAGAATCGAGGATTTCAATAATTGTATTCACGGAAGATTATGGATATTCTAGAAG
GTGCCTAGATGAACTTGTGAACATCCTTGAAAGGAAGCAAAGTGCTGGTCATATGATTCT
ACCTGTGTTCTATCGTGTAGATCCATCCCATATTAGAAAGCAGAGAGAGTCGTATGCGAA
AGCATTTCATAATTACGAAGAGCAGATCATGGCGAAGAAGGTTGAAAGAAGGAATGAGCA
CATAGCAAAGATAAAGATATGGAGATCATCTCTCACAGAGGTTGCAAATATGGCAGGGAT
AGTTCTAGAAGACGGGGATGAGCTGAAGTTTATTCAAGAAATTGTTGAGGACATTTGGGG
TAAGCTGTCTCGTAAAGTTTTGAGTTTCGCCCCATATCCAGTTGGAATATACTCCCGTGT
AAAAGAGATTAATTTCTGGTTACAAGATAGCTCGACTAATTCTCGCACATTGATGATTTA
TGGAGAACCTGGAATAGGGAAAACAACCATTGCCAAAGCTCTTTTTAACCTACATTGTGA
CAGATTTCAATGCAGCAGATTTCTTGGAGATATTAGAGAAATTGCAAAAGAAAGCTGTGG
TCTGATTAACCTACAGAAAAATCTTCTTTCTGATCTTTTGAAAGAGGATAAGATTGATCT
AAATGATATTGATAGAGGAGCTTCCACGATCAAAGAATGTTTAGTCCACAAAAAGTTTCT
TCTTGTTCTTGATGATGTTGATGATTTGAACCAACTGAAAGGACTTCTTGATTCAAGAGA
GTGGATTCCTCCAGGGAGTAAAGTTATTATAACAACTACAAACGAACACTTGCTAAACCC
TCTTGATGCTTGTGTGATGTATGAAACCAAGAGGATGAACAATTATGAGGCGCTTAAGCT
CTTCAGCTTGCATACTTTTGGTCAAGACCATCCCGTCAAGGAGTACATGAAACACTCCAA
GCAGATAGTTAAACATTGTCGAGGGCTTCCTTTAGCTCTTCAGGTTCTAGCCTCTTCGCT
ACGTGGTGGAAGTATAGATATGTGGGAAGGTGCAATACAGAAATTAGAAAGATATTCTGA
ATGCCATAACCATAAAGTTCTTGAACTAAGCTATGAAGCTTTGCCAGATGATCATGATAA
AAATGTATTTCTTGATATTGCTTGCTTTTTTGTCGGGAAGGACAAAGATTATACAATCAA
AGTTCTGGATGAATGTGGTTTCCATGCTACTGCTGAAATACAGAATCTCATTGATAGATA
TCTCCTGACAGTGACTCCTGATAACAAGCTAATGATGCATCAGTTACTACAGGAAATGGG
TAAAGAGGTCATCTGCCGAGAATCACCCATTGAACCTGGTAAACGCAGCAGAATCTGGCA
TCACAAGGATGCCCTTAGTATACTGCATGAAGAAACTGTAAGGCTCATTCCTCCTGTACC
AATTTCGTTATTTTTCCTGGAGCTCATTTTCACTTCAACGTTACTTTCCATGTCAGGTTA
CAGAATCTATTGAAGGGCTTGTTCTTAAAATGTGTGGATCAGATGAAAGCAAACCAGACA
GACATGAAAGTATATCAAAAAGACCTTACTTCAATGATTCACAGAGCACTTCAACATTGA
CTCTCAAGAAAAATTCATCAAAGAGGCTTCGCGTAGGATGCCTCTCTTGGGGTCTGGGGA
ATTCTGTTTTGGCAAGATCACAGACTGTACAAAATGAAGCTGGAATGAGTGCTAAAGCAT
TTTCTAAAATGCAAGAATTGAGATATCTTGAGCTTGAGAATGTCCAGCTTTCTGGCACCT
TTGAAGGATTTCCAAAGAAATTAAGATGGATGCGCTGGTATGGACGATTCCAATCAACAT
CCTTCCCAAATGGCTTTCCTCATGAAAATCTTGTAGTTCTTGAAATGAACAATAGCAACT
TGCATCAAACCTGGGAGGGAGCAAAGTCTCTACGATCATTGAAGATACTTGATCTTGGTC
ACTCACACAGTCTCATGAAGACCCCTGATTTCTCTGGAATGCCGAATCTAGAAAGAGTGA
TTCTTGAAGATTGCATAAATTTGGTTAAGGTCCATGAGTCCATTGGAAGACTCCATAAAC
TTCTTGTCTTAAATCTGAAGGGATGCGAGAGCCTTAAGAAGCTTCCAAGGAAAATTTGGG
AAATCAAATCCTTACAAGAACTAACACTCTGTGGGTGCTCAAAGCTGGAGCTTTCCAGGA
TTATGAGAAATGGTAAGTTTTTGCAAGCACTTACACGGGATGTGACTAACAGAGATCAAT
TTTCCTCTAAGGCTGAAAAGCCAATATGCAGCGACTCTCTGTCTGCTAAATCAGTCTATT
CAATCTTCTGGTCTTGGATGTCACTGTGGCCAAAGTCAGCAGGTTCAATGTCAGATATCT
TCCAGATCACCTTACAAAGTTTGGATATTTCACATAGCAATCTGACCGACACTCTTATTC
CCTACGACCTTTCTGTCCTATCCTCCTTGAAATATCTGAGTCTAAGAGGAAATCCCATTT
CCACCCTGCCGGAGAGCCTGAAGAGCCTAACTATGCTGCAGTCCCTTCAGTTAGCCGACT
GCACAAGGCTCCAGTGGATCCCTGAGCTTCCGTTGAGCTTACAAATATTGAATGCAAGTA
ACTGCAGATCACTGAACAAAGTAACAAATTTACCCAATTTCATGAGGTCACTTGACTTGC
ACTTAGAGAATTGTGAAAAACTGGTTGAGGTTCAGGGAGTATTCAAGCTAGATCCTATTA
GAGACATTGATGATATCCTCGATATGTCTTGCCTAGATAATTTGGAGGTCAGAGCAGTAG
ATGTGGAACTTTGCAACTATCTGTCCTCAACAAAAAGCAAAGGTCCCCTTCAGGGACTAT
ACGAGTTTGGTATACACAACATTTACATTCCTGGAGTCAAGGTTCCTACCGAGTTCAGCA
ATATAAGCACAGGGAGCTCAATAGATTTCACTGTGCCTCCACTTCCTAATGCTAAGATCC
AAGGATTAAAGATATGTGTTGCTTATGCAGAATGTCTTGAAGAATGTTTCAGTGAAAGAC
ACTTCATAAAAGTGAGCAATAAGACCAAGGGAATCAAATGGATTTATGGTCCAACAATTT
TTGGAATTGCAGGTCCTGGTAATCCAATGCTATGGTTTAGTCATTGGAAGTTTGGAAACC
AGCTAGAAAGAGGAGATCAAGTTGTTGTTTCAGTAAGCATGGGTTGCTTAGTTAAGAAAT
TTGGTGTATATCTTGTATGCAGCGAACAAAGTGAGGAAGAGGAAGACACCCTATCTAATG
CAGAAGGATGTCGCCGTCTTTCCTATCCACTACAGCATGCAATTGGTGGAGATTTGTCTC
CTTATGAGCTAAGTTCAGGGATATTTTCGACTGACCACCCCAAAATGGACATTTTTGCGA
GTGACCCCGTGAATATTGACCGCTCCTTGCACCTAACCAATGGGCCGGATAGATGAACCT
GGCCATGATGGCCCAGATTCCGTTTTGGGTAGGTTGATCTACTTAGCAAAGTCAGCAATT
TGAAGTTATCCATATTGGGGATTAACTGTTCCCTTCAAAATCCTACTTCTAGTAAATTAC
GTTGTAAAACCTAACAAAAATACCAGAGACGAAATTAGGATTTTTCATTTGAATTCTAGA
AAACACAGCTTACATATTTGAGTCAGGTTCTGTGAAAGTAGCAGGAGGAATGGCCCTAAT
CTAAACAATGGAAGAAAGTTCATATTTATGATCCTCGTTCATATACTCGTAATTTCTGCG
ATATTTATCCTCCTCACTGTGATCCCAAGCAATGGCAATGGCAATGTCGACAACGAGGAT
AAGCTGTCACTTACAGAGTTATGCGTGAAGCATTATTTTAGTCCAAAACGGCCTGAAATA
ATACAAAGTAGTAGTACTACTGTTAATTTGAATGCAGAGACTTGTTTCGTCGGAATATTG
TTTGAGTGGAAAATTTGATCCTGAATTCGTCGGAGCTCTCAGAAAATTCGTTCCAAAATT
CAACAAAAAGGAAGATTTCTTAGTCGCATCACTCGATGTCAGCAGATCTATCCGTGACTT
TAGTTCAATAGGATTTTCTTTTTGTATAGGAACTAGAAATTAACTAGGTTTTTTGTTTTT
C