Microarray Probes on PGSC0003DMT400033769

Probe IDChipProbe Sequence
CUST_42778_PI426222305 JHI_St_60k_v1 GCTGAGATTTTTCCAGTTGGTGCATATATTGCGTACTTAGTCAATATATCATAGCTACAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033769

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033769 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G13340.1 +1 4e-67 227 116/185 (63%) Regulator of Vps4 activity in the MVB pathway protein | chr1:4569622-4571043 REVERSE LENGTH=409

Transcript Sequence (1799 bp)

>PGSC0003DMT400033769 1799 pgsc_dm_v3.4
TGAGCTAGTTTCATTTGTTCCTATCTTCTAGTCTCTTCAACAACCACCAACCATTAAAAA
AAAAAACTCTTATTGTGTTCAAATTTATAAGAGTTTATACTTCTCTTTCTTTTACTTGTT
TCTCATTGAGTGAGGAAACAAACAAGTGAAAGGGAAGTAGCCATGGGAAGAAAACTTGAT
GCTTTACTAGGAAGAAACTTTAAAATTAGTAAATTCAAGGCCACTGCAAATTTAGCCATT
TCCAGGGTTACTGTACTCAAGAACCAACGCCAAGCACGGTGCTCGATCGCGCGGTCTGAT
GTGGTTCAGCTCTTAAACCTTGGTTTCCATGAAAGAGCTCTTCTAAGGGTTGAGCAAGTG
ATCAAGGAACAAAATATGTTGGATGTGTTTGACATGATAGAAGGCTATTGTCTTCTCACT
ATTGAAAGAACCAACCTTATTCAACAAGAGAAAATATGTCCTGAGGAACTGAAGGAGGCG
ATATCGAGCTTGATTTTTGCAGCTTCAAGGTGTGGTGAGTTCCCAGAACTTCAGGAGCTT
CGAGCAATTTTCACGTCAAGATTTGGGAAAGAATTCGCAGCTCGTGCTGTTGAGTTAAGA
AACAATTGTGGAGTAAATACAAAGATGATACAAAAGCTGTCAAAAAGGATGCCTAGCTTA
GAACAAAGGACCAAAGTGCTTAAGGAAATTGCAGCAGAGAATAACATTGTTTTGAAAATT
GAGGAAATAATTTTGGAAAATACAGAGGAGGAGGAGGTCATCGCGAAAAGGAAGGACCAG
CCTGAAGATCACATACCAGTTTTACCTCAAAATGTAGACCATGAAGCTAGGAGAAAATAT
AAAGATGTAGCAGCTGCAGCTCAAGCAGCTTTTGAATCTGCTGCTTATGCAGCAGTAGCT
GCCAGAGCAGCTGTGGAACTCTCTCGGTCTGAATCACGTGATCTGGATGACCCCAAGAGT
CCGAGTCAGAAGCCAAGGAATGTATCGGACTCTCGTGAGGATTTGAAATCTGAGTTTCAT
GCAGGAGAGGAGAAGAATAATGAGGGAGTTGAGAAAATTGAGACTAGTCAGAACTATGGT
TTTCATTCTGAAGTCGACCAATTCTCCGATGGAGATGAGGTGGAAGAACTCAAACAGAGG
AAGTTTGAAGAACAGTTCAAGAGATCAGTCTCTGTTTCAAGTTCTGATATTTCAGCAGAC
GACATTCTTGTTGATGAGGTGAAAAGTCCAAGACATGGTGTAGTTTATGATGAAATAGAT
GAAGAAGTTGGAGAGGAAAACAGAATCCCATCATTAAAACGTCCTAAGAATGAAGTTTTT
GGTTCTCCGGTGCACCAAGCAGGAAATGAGAAGGAGATTGAAGGATTCACAAAGCAAGGT
GCAGAAAAACTAGATATAAATAAGAAGCCAATATCAATGAGAACAAGAAAGAACCTTCAC
TGGTGAACCAAGATCGGTTATATGTTAACGAAAAGGAGATTGAAGGATTCACAAAGCAAG
GTACAGAAAACCTATACATAAATAAGAAGCCAATATCAGTGAGAACTAGAAAAAAGTATC
ACTAGAGACCAAGGATGAATAAATGTTTGCTGAGATTTTTCCAGTTGGTGCATATATTGC
GTACTTAGTCAATATATCATAGCTACATATTTTCTTTAGCTTTGGAGATTTTGTAAGTTT
GCAGATATATTTTGTGCTTTTGTCAATATAATGTAGCTTCATATTTTGTTTGCTTGATTA
AGACAAATGCTGTGATATTTTATAATAATCGAAGCTACAGCCAGACACATAAATTCTTT