Microarray Probes on PGSC0003DMT400033609

Probe IDChipProbe Sequence
CUST_317_PI426222305 JHI_St_60k_v1 TGGATAGGCCAAAGAAGGTCTCTTGATGAAATGCTATATCTTGGACGACTGAGATGTCGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033609

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033609 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc04g076120.2 +1 0.0 629 319/436 (73%) genomic_reference:SL2.50ch04 gene_region:58665257-58669513 transcript_region:SL2.50ch04:58665257..58669513+ go_terms:GO:0016754 functional_description:Serine carboxypeptidase 1 (AHRD V1 ***- B6TC80_MAIZE); contains Interpro domain(s) IPR001563 Peptidase S10, serine carboxypeptidase
TAIR PP10 AT1G73300.1 +1 7e-133 394 212/437 (49%) serine carboxypeptidase-like 2 | chr1:27559673-27562048 REVERSE LENGTH=441

Transcript Sequence (1308 bp)

>PGSC0003DMT400033609 1308 pgsc_dm_v3.4
ATGCTCATAATTCTGCATGAACCCTCTGAGTTGAGCATTCTTGAGATTAGTAGTATCATT
GAAGTTCTTGAGTTCCAAGTATTTGAGAGAGTTTGTGCAGAAAGAAGAAAAACAATGGTC
AAAAGAAAGCAAAATAATCTTGTGCATTGCTGCAATCTGTTTTCAGTTCTTCTTGTTGTT
GTTGCAGAAGTAATACATTTTCCAGAGTGTGTTGAGGCTGCTGGTGCACCTGTTAAGTTT
CTTCCAGGATTCCAAGGGCCACTTCCTTTAGAACTTGAAACTGGGTACATAGGAGTGGGT
GATTCAGATGATGTTCAACTATTCTACTATTTCATTAAGTCTGAGTCTAATCCAAAATCA
GACCCTCTTATTTTATGGCTAATTGGAGGCCCTGGCTGCTCTTCTATATCTGGCCTTCTC
TTAGAGATAGGTCCAATAACGTTTGAGCCAGCGGAATATAATGGTAGCTTCCCCTCACTG
GTCTTGAATCCTCATACATGGACAAAGGTGGTAAGCTTTATATTTTTAGATCTTCCAGTT
GGTACTGGATTTTCCTATGCAAGAACTTCTGAGGCTCGTCAATCAGATGATCTACAAGCT
AGTGATCATGCATATCAATTTCTACGCAAGGGATATTTACTGGGAAATCCGGCTACATTT
CATGGTGAATACAATTACAGGATCTCATATGCTCATGGAGTGGGTCTAATTTCTGATGAA
CTTTTTGAGTCCCTGAAGAGAAACTGTAAAGGAGAGTATTTCGATATACATCCTAGGAAC
ACACAATGTTGGAATGATAGGCAGACTTATGATCAGATGCTTGGTGGAATTACCAATGCG
CACATTTTGGAGCCCAAGTGTGAGTTTGCTTCACCAAGGCCACAAAAATGGATAGGCCAA
AGAAGGTCTCTTGATGAAATGCTATATCTTGGACGACTGAGATGTCGAGGCAGTATTGGT
AAATGGAAGCGATGTGCTGGGGATGCTTTGCCTTACCAAAAGATAATAGGAAACAGCATT
CCATATCATGCAAATCTCAGTGTCAAAGGCTATAGGTCCTTAATATACAGTGGAGATCAT
GACACGATGATCCCTTACACATCAACCGAAGCTTGGATAAGATCTCTTAACTACTCTATT
GTTGATGATTGGCGACCATGGATTGTTGATGGTCAAGTTGCCGGGTATACAAGGACATAT
TCAAATAAAATGACATTTGCCACAGGAGGAGGACATACAGCTCCAGAGTACAAGCCTGTT
GAATGTCTAGCCATGCTAAGGAGATGGTTATCTTATCAGCCTTTGTGA