Microarray Probes on PGSC0003DMT400033371

Probe IDChipProbe Sequence
CUST_8936_PI426222305 JHI_St_60k_v1 TCTGTTATTCCTTTCCTATCAGCAGGTACCTCCATCTTTTGCCATCAAGTCATCAGATGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033371

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033371 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G28530.1 +2 7e-55 199 112/241 (46%) unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; Has 20 Blast hits to 20 proteins in 6 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 20; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10032127-10035496 REVERSE LENGTH=614

Transcript Sequence (2082 bp)

>PGSC0003DMT400033371 2082 pgsc_dm_v3.4
GTGCTACATGATACTGATAGGTTGAGTTCTGTTATTCCTTTCCTATCAGCAGGTACCTCC
ATCTTTTGCCATCAAGTCATCAGATGAACGAGTCATTTCTGTTATTGCAGAAGTTATTTG
TCTTTCTGCTCTCGAAAGCACAAAAAAACATTTCTTTAATGGAACTCCTGGTGGAGCCGC
AAAGAAATTTTTCCCCTGGTTTGACACACATAAAAGCATTGTCTCAAAAGATTCCTCTGT
TACTCTATACAACTTAATGGAATATGAGATAGTTGCAAATGCCAATGTTTTGCTCCAGAA
ATTTTCTTCCGAAAGGGCGAATTACAGACCAAGGGAGGGAAGATGGATGGGCAATTGGTT
AACTTCAACTGCATACTCCAAACTGGAACAAATTGGAGGCCCTGAATTTATTACTTGGCT
GAGTGAGTGTGTACCTGCTTACAAATTGCAGATTGATGCTGAGAAACTTGACAAAGTGAA
ATTTGAAGGGTGGAAGGAAACAACAACAAACACATGGGAGGTTTTTCTGACTCACTCCCA
AATGGTTGGTCTAAGTGACATTCTAGATATGTATTATGAAGATGTCTATACACTTCCCTA
CAAACAATTATCATCGGGTGTTATTGCAAAATCTTTCAATTCGCCATCTAGCAAGAGAAG
CATTTCTATGTCAAAGGCAATCTCTATGGTCCTTGCAAGTGGAATTTTTCTTGTTGCTAT
AAGAATTCTTGGTCAACGTTATCTTCCTTATCTCCCGATTAGAAAGCACTATCATCCGGA
TGTTAATCCAGTCAATTCATCTGACATGATCTCTATTCAGCCTCAGTCCATGGAATCTTG
CAAGGTATGGTTTTTATTTGTTCAAACACACCCTCAGTTCTATTACCTGTCATAAGAAGT
TACTGTTTCTATGACCATGTAGTGGATGATACATGCTTTTGCATTATTGGCCACTTTTAT
TGTTTTTTACACTTTTAAGTTGATTATCATTTTACCCTAGGCGTTCTGTCTCTTTTTATC
AGTAGGTAATATTGTTCAATCATCACATTGCCAAATGCTCTTTGTTTCTGTAGTTGGAAG
ATTACTGTGTCTCCATTGTTAGGAGAATCAAGGAATTTTATTGTTGGCCTGGAGATGTAG
TGATGGGTTCTGGCAGCTCTGCTTGGATTGGGGAGCTTCCAATATACCTGAAGAATGAGA
TGGATTCCAAAGTGTTAGATCTCAATTCCAGCTCCACGCCATCGGAAGGAATTGAAGATG
AGATGAAAGCAGCTGCACAAGATATTGCCAGTTATCAGGTTGTTTTATCTGGGGATGGTA
AAATTGTTGGATTCCAGCCTACAAGTCGTGTTGCTGAAAGTCAATGGGATGCAAACCCTT
TAGTGAAAGAGCTCTATGGAAAGGAAAAGCTTTCTCCCGACTTGATAGAACAAGGTCTCA
AAATAAGCCGCTCCAGTGATGCTGTTGTACTGGAATTATTGATGTCAACGAATCCCCAAA
GTTCATTTGCTTTGGTAAGACCAGTTACTGAAAATAGTAGATGAACATTTTTGGCACCGC
CCCATTCAATATTTGTACAACTAGTTACAGTGCTGGACAAGACTTTTTCCAGGTATAAAG
GATCAAGGGAGATTTACATTTCTTTTTCGTTTCTTCTAGTCTGATCTCATCCTAAATGTG
AGTTTAGTTGGCATCGCTGCAGCGTAGTGTGGTTGAAGAACAACCTTTGTATTCTCACGT
TAATGCAAAAGTGAGTTAGTCACAATGTGTAGCCAACTTTCGTACAGACAAGACATAAAA
GAAGACTTCCCACAAACTTTACTTTTGTCTAGTTATTGCATCCACTAACAAGGAAGCAGA
AAACCATTTGGTGGAAGACACCTGGTCCATCCCAAACCTATGTTGCTCAGACTCTTTAAA
AATCTTGACAGGTGCGTGTCGGATCCTCCAATGTTTACTTGAGAATTATGCTCACGAGCA
GGATCCTAGCTTAGGTGCCCCTTTGCACGTCTCTGTTACTCTTAGGAAGCATCTGCCCCC
TGAATCCTAATAAACTACCCAAGAAACTCCCAAGGATTGTTG