Microarray Probes on PGSC0003DMT400033320

Probe IDChipProbe Sequence
CUST_28871_PI426222305 JHI_St_60k_v1 TGGGTCTTGCAGCCATTAATGGGGTCTTTTCTGCTTGAACAAACAAGAAAAAATGGCAGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033320

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033320 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G65207.1 +1 1e-06 44 34/82 (41%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G10040.1); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:26052364-26052585 REVERSE LENGTH=73

Transcript Sequence (496 bp)

>PGSC0003DMT400033320 496 pgsc_dm_v3.4
CCAAAATATCCAACAATTTATTTCATTACACATCAAATTAAAAGTTGTCCAAATCAAATT
TTACAATTTAGTAGTATGGCTGATATTGCTATGTTGGTTGCAGAAGAGTATGAAAGGAGA
GTGAAGAATTCAAGAAAATTTGGATCTGAAGAAGAGATTCAATTATTCTCTTATTTCTCT
GAAATTTTAGCTCAAAAATTTGATGGGTATTCTTCCAAAATCAACATGACTTTTGGAGAA
ACCAAAATTATTGAGCCTAAAAGTGAAGTGGGTCTTGCAGCCATTAATGGGGTCTTTTCT
GCTTGAACAAACAAGAAAAAATGGCAGCTAATTTACTTTTTTTTTTATTTTTTTTAATTT
TGCATAATTATGAAGAGGAAAAAAAGTAGTTGTAAATGTCAGTTTAAGTTTTTTTTTTTT
TGGGTCTATAGAATGGTAACTATTTCAGCTGCTAATTCTGTTGTTTGTTCTTCATGTAAT
TTATGCAATTCACAAT