Microarray Probes on PGSC0003DMT400033260

Probe IDChipProbe Sequence
CUST_2889_PI426222305 JHI_St_60k_v1 TTGGAGCCCTCTTCAACTTCAGAAAAAAGGCACCATTTTTCATTTTATCTAAGGATTCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033260

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033260 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G60810.1 +1 3e-85 260 127/179 (71%) unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1499 (InterPro:IPR010865); Has 444 Blast hits to 444 proteins in 143 species: Archae - 0; Bacteria - 268; Metazoa - 0; Fungi - 0; Plants - 51; Viruses - 0; Other Eukaryotes - 125 (source: NCBI BLink). | chr3:22470579-22471756 FORWARD LENGTH=214

Transcript Sequence (1064 bp)

>PGSC0003DMT400033260 1064 pgsc_dm_v3.4
AAAAAAGGCACCATTTTTCATTTTATCTAAGGATTCAAGAAAAGGGAAAAGCAAAAACCA
AGAAGAAATAAAGCAGCTCTAATTCTTCCTTTCTCAGTAATGGCATCATTAAATAGCCAC
CATTTTTACCCTAACAAGTTCTCAAGTAGAGTATATACTAGTAAATCTTCTTTCTCCCAT
TTCATTGTTTCATGTAAGGAGCAGCAGGATGAAAACACCAAACAAGTGGGTCGCAGGGAA
ATAATACTAAGAAGCAGTGAAATTGCACTTCTTGGAGCCCTCTTCAACTTCAGTGGTAAA
AAGCCAAATTACTTGGGAGTTCAAAAGAATCCACTTGGTTTAGCTCTTTGTCCAGCCACT
AACAATTGTGTTTCTACTTCTGAGAACATCAGTGATGCTACTCACTATGCACCTCCTTGG
AACTATAACCCTGACGGGAAACGTGGTAACATCAGCAGAGAAAAGGCAATGGAGGAATTA
CTTCAAGTGCTAAAATCAACAAAACCAGACAAGTCCTCTCCAAGAATAATGGAGAAGAAA
GACGATTATGTGCGTGTGGAATATGAAAGTCCTATCTTGGGGTTGGTAGATGATGTCGAG
TTCTGGTTCCCTCCAGTCAAGAAATCAATTGTACAGTATAGAGCAGCATCTCGCATGGGG
AATTATGACTTTGATGCTAATAGAAAGCGAATCAAGGCGCTGAGATTGCAACTAGAGAAG
AAGGGATGGGCATCAGAGGACACAGTCTGAACGGCATGATCTTCACAAAGGACAACTTAT
TCCTTACTTAGCATGATGAAAAAAACCATCTACTGAATACATATTCTCATATATTGAGCT
TCTTTAATTTGTAAAAGCTTAATAGAACAGATGAAATGACACCAATATTATTTCTGGGCA
ACATGTTAGCATTTGACACCAACTGGTTAATGGTGAAGCAGTCCCACCGGCCACCACTAC
ACCACAACTCACATCACATTGGTGACTTGGTATGGGTAGTAATTTGTATGCCTTACTCTT
TTCATTTCATCAAGAAACGATGCATCATCCCATTACTTAACTTC