Microarray Probes on PGSC0003DMT400033096

Probe IDChipProbe Sequence
CUST_34162_PI426222305 JHI_St_60k_v1 GAGTCCAGAGAAAGAAGATGCTTCTCAACTGGAGTTATATTCTTTCATTGCTCATATTAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033096

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033096 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G18570.1 +1 6e-35 128 76/168 (45%) UDP-Glycosyltransferase superfamily protein | chr2:8063429-8064841 FORWARD LENGTH=470

Transcript Sequence (534 bp)

>PGSC0003DMT400033096 534 pgsc_dm_v3.4
ATGGAGCTCATGATGGGACTAGAGCGTAGCAAACAGAAGTTCGTATGGGTGTTTAGAGAT
GGTGATAGAGGTAATATTTTTAGTGAGGAAACTAGAAGATTTGAGTTGCCAGACGGGTTT
GAAGAAAGAGTAGACGGTTTCAGGTTAGTGGTCAGAGAATGGGCGCCACAACTTGAAATC
TTGGCTCATTCTTCCATAGAGGGGTTCATGCGTCATTGCGGATGGAATTCTTTCATAGAG
TGTATTACTGCGGGGGTACCAATAGCTGCTTGGGCTATGCATTCTGAACAGACAATTAAT
GCTTTCATTTTGACAGAAATCTTGAAAACAGGCCTTCTCGTTAGGGAGTGGAAGAAACAC
GAGAAACTTGTCACTGCATCTGCCATTGAGAATGTCACGAGGAAGTTAATGGCATCAGAA
GAAGGCGACGAGATTAGGAAAAGAGCAGAAGAATTGGGAGCATCAGTAAGGGAGTCCAGA
GAAAGAAGATGCTTCTCAACTGGAGTTATATTCTTTCATTGCTCATATTACTAG