Microarray Probes on PGSC0003DMT400033012

Probe IDChipProbe Sequence
CUST_43413_PI426222305 JHI_St_60k_v1 CAGATAATAATGGGAGGTCACCGAGGAAAACGCCTGGTAATCGTCTCTGTTAATCTTCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400033012

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400033012 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G04560.1 +1 9e-17 74 64/117 (55%) AWPM-19-like family protein | chr1:1245070-1245888 FORWARD LENGTH=186

Transcript Sequence (387 bp)

>PGSC0003DMT400033012 387 pgsc_dm_v3.4
ATGGCGGTGGGAAGAGGTGGCAGAACCTTTATGGGACCATTGTTGGTCATAAACTTAGTA
GTTTATTTAATAGTACTAGGACTTGCTGGCTGGTCACTTGACAAATACATTGATGGCGAA
CAGAATCATCCTCATTTAGGTGGGAATCCATCAACAAGTTTTATGTTGATTTTTGCATTA
ATTGGGGGAGTAATGGGTGCTTCCTCTATGCTAGCTGGGTTTTTTCATCTCCGAAAATGG
ACTAGTCACAGTTTGGTTAGTGCTGCTTCTTCAGCTATAATCTCTTGGGCCATTACTGCT
CTTGCTTTTGGCCTTGTTTGCAAGCAGATAATAATGGGAGGTCACCGAGGAAAACGCCTG
GTAATCGTCTCTGTTAATCTTCATTGA