Microarray Probes on PGSC0003DMT400032988

Probe IDChipProbe Sequence
CUST_43375_PI426222305 JHI_St_60k_v1 GGAGGATGTTGGAGAAGAGTACTAATGATATGAGTAGCTTTATTATGTAATATCGGATTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400032988

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400032988 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G38450.1 +3 0.0 726 351/500 (70%) cytochrome P450, family 735, subfamily A, polypeptide 1 | chr5:15394000-15397233 REVERSE LENGTH=518

Transcript Sequence (1797 bp)

>PGSC0003DMT400032988 1797 pgsc_dm_v3.4
ATCTTAGTGAGTTTTATATTTTTTTTCTCTCACTCCATTGGAACAAGAGTGATAGTTGTA
TACTAAAAGTAACCATCATGGCTATGGTGATAGTGATACTTTTGATTTGCATCATTTTGA
TGTCACTGAAAATTGCCTATGAAACTCTCTTATGGTTAACTATCTAATTCCCAGACGTAT
CACTAAAATCATGGAAAAACAAGGTAGTGCGTGGTCCTAAACCTCGATTTCTTGTTGGAA
ATATCTTGGATATGGCTTCTCTTGTCTCCAAATCAACCTCAAATGACATGGATTCTATTC
ACCATGACATCGTCTCTCGCCTTTTGCCTCATTATGTTGCCTGGTCTAAGGTTTACGGGA
AACGATTCATTTTCTGGAACGGGACAGAGCCGAGAATGTGCTTATCAGAAGCAGATTTAA
TCAAAGAGCTTTTTTCAAAGTACAACACTGTTTCTGGAAAATCATGGCTACAACAACAAG
GTTCGAAACATTTTATCGGCCGCGGACTATTGATGGCTAACGGCGACGATTGGTACCATC
AACGCCACATTGTTGCTCCTGCTTTCATCGGAGATAAATTGAAGAGTTATGCGGGATACA
TGGTGGAATGTACTAGTGGGATGCTTCAATCACTTGGAAATGCGGTTAAATCAGGCCAAA
TGGAGTTCGAGATCGGAGAGTACATGACTCGACTCACTGCTGAAATAATTTCGAGAACAG
AGTTTGACAGTAGCTATGAGAAGGGAAAACAAATATTCCATTTATTAACCATTCTACAAA
AAAAGTGCGCGCAAGCTAGCAGACACTTGTGCTTTCCCGGAAGCAGGTTTTTTCCGAGTA
AATATAACAGAGACATAAAAACATTAAAAATGGAAGTGGAGAGATTACTGATGGAAATAA
TACAAAGTCGAAAAGATTGTGTAGAAATTGGACGAAGTAGTTCGTATGGGAATGATTTGT
TAGGAATGTTACTAAATGAGATGCAAAAGAAAAGATCAAGCAATGGATTCAGCTTGAATT
TGCAGCTTATTATGGATGAATGCAAGACTTTTTTCTTTGCTGGACATGAAACCACTGCCC
TTTTGTTAACTTGGACTGTTATGTTGTTAGCAAGTAATCCCTCTTGGCAGGATAAAGTTC
GTGAAGAAATCAACCAAGTTTGCAAAGGAGATTCACCTACTGTTGATCACCTTCCAAAGC
TCACTTTGTTGAGCATGATAATCAACGAGTCGTTACGACTATATCCACCAGCTACTGTAC
TACCAAGAATGGCATTTGAGGATTTTAAATTAGGTGATCTTAATATACCTAAAGGTTTAT
CAATATGGATTCCAGTACTTGCCATACATCATAGTGAAGAAATTTGGGGAAAAGATGCAA
ATGAATTTAGGCCTGATCGTTTTGCCTCTAAGCCCTTTACTGCCGGACGGAATTTTCTTC
CGTTCGCCGCGGGTCCTCGGAATTGTGTTGGACAGTCATTTGCCCTAATGGAAGCTAAGA
TTATATTAGCAATGTTAATATCAAAATTTCGATTCACCATTTCAGAAAATTATCGTCATG
CACCTGTAATTGTCCTCACAATTAAGCCTAAATATGGGGTTCAAGTCAAATTAACACCTT
TGATCACTACTTAGAGAGATTAATTTTTGGTCTTTAGAGGATTTGTTTTCCTCCTTTTTG
CCATTTTTATTTCTTTTTTTGCTGAAGAAGAGTTTTTGGGGAGGATGTTGGAGAAGAGTA
CTAATGATATGAGTAGCTTTATTATGTAATATCGGATTGAGATGAGTTCAAATGAAC