Microarray Probes on PGSC0003DMT400032780

Probe IDChipProbe Sequence
CUST_23917_PI426222305 JHI_St_60k_v1 GTGGTCTGATTTTCTTGACTTAGATGGAAGTTGAGAATTCTCTTTAATTTGCATTCCAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400032780

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400032780 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G19270.1 +3 4e-24 103 54/128 (42%) DA1 | chr1:6663327-6665845 FORWARD LENGTH=532

Transcript Sequence (1072 bp)

>PGSC0003DMT400032780 1072 pgsc_dm_v3.4
GAAATCTTAATCATTTAGCATTAAAGACTGAATATTTCCTGATTCACAGAGAAAAATCTG
CATAACTAACCACCGTTTCCAGCTATTGTTTTTCCCCAAGGATTGGTTACTCTTCCCATG
AGTCACCTAAATTGAGACATTAAGGAAATATTGAATGGTGACGAGTGGGGGTTGCAGATG
TTGCGTGCTATCCATATTCTACCATTAGTGGTCTGATTTTCTTGACTTAGATGGAAGTTG
AGAATTCTCTTTAATTTGCATTCCAGTTTTAAAAGAATGTGTAACAAGTTCCCCACTTAC
AGTTTATGTATGCATCAATGCTCTCTGTAAACAGGTTGGCCATCGGATCAACTTTGGCTC
ATGAACTGATGCATGCTTGGATGCGCGTTCAAGGCTATAGAGGACTGGCCCTAAACATTG
CAGAAGGTCTTTCTCAGGTTATGGCTCACAAGTGGCTAGAATGGCAATCTTTCACAGGCG
ATGACTACATGAAGGGTACAAGTGAAAAAGCTCAGTTCTTGAGAAATTTGAAAGAATTTA
TGAAAGATGGAATAGAGAGAAGATATTCTGAGGCATATGGTCATGGATTTAGAGAAGCAA
AATGGGCAGTTGAACGTTATGGTTTAATATACACACTCAAGCATATAGCTCGTAAGGGCA
AGTTACCTGAATGACTTAATTCAGCAAAATGGGCAGTTGAACGTTATGGTTTAAGGTTCA
CACTCAAAAGCATATAAGCTCGTAAGGGCAAATTACCTGAATGACTATCGAACCCTCACC
AACAAGGTGAGAGTTCAGGTAGTCAACCAATTAAGCTACTAAGATTCTCCTAAATGACTT
ACTTCTCCGGGTGACATTATTAATTTTTGTGTTAATTCATTCATCATTGGGATGAAATTG
ATGGTTCTTGGACAAACATTTCTGTGAAAAACTTGTAATTTTTTGTAATTTACTTTTGTG
ACTCCAAATTGAGGCCCTGAAATTACATGGGTAACACAAATAGTACATAGGGATAGTGAC
TTATTTTTCTTACAACTTTCTTGACTTTTAATATCACATTACTTGCTCGAAT