Microarray Probes on PGSC0003DMT400032756

Probe IDChipProbe Sequence
CUST_24067_PI426222305 JHI_St_60k_v1 GGGTGGGTGGTTGTCGTTTTGTATGACTGTATATTCCTTTGCTTTTATGTTTTCTAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400032756

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400032756 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G64260.1 +1 8e-131 382 194/287 (68%) EXORDIUM like 2 | chr5:25703980-25704897 FORWARD LENGTH=305

Transcript Sequence (1209 bp)

>PGSC0003DMT400032756 1209 pgsc_dm_v3.4
CTTCTTTCTCTCTTGCTCAATACACTTGATTAAAGACTTTTAAATACTCACAATATGGCT
TCAAATTACATTTCTGCCACTGTTTCTTCGATCCTATTGTTCTTATTGTGTTCCTCTTCT
CTCTTCGGAGCTTCCATGGCTGCTCTTGTTCAGGAACAACCTCTTGTTCTCAAATACCAC
AACGGTGCTCTTCTTAAAGGAACCGTGACCGTTAATCTCATATGGTACGGTAAATTTACC
CCTAGCCAACGGTCTATAATCGTTGATTTCCTTCAATCGTTAAACTCCCCAAAAGCCCCA
AATCCTTCAGCTGCTTCCTGGTGGAAAACAACTGAGAAATACAAAACTGGTGCCTCCACT
GTTACTCTAGGAAAACAAATTCTCGATGAAAATTGTTCTTTAGGAAAATCTCTGAAAAAT
TCACATATTGTGTATTTGGCTTCCAAGGGTGGTTATATGGGTAGGTCGGTGAACTTAGTG
TTGACGGCGAAGGATGTATTCGTGGAAGGATTTTGTAGCAGATGTGGGTCCCATGGCTCA
AGTCGGGGTAAAGTCCGTTTCACTTACGCTTGGGTTGGTAACTCGGAGACTCAGTGCGCC
GGTCAGTGTGCTTGGCCGTTTCATCAGCCTATCTACGGCCCACAAACGCCGCCTTTATTG
GCGCCGAACGGTGACGTTGGCGTTGACGGGATGATTATCAACGTGGCAACGGTTTTGGCG
GGAACCGTGACGAATCCGTTTAACAATGGATACTTCCAGGGGCCAGCGACGGCGCCGTTG
GAGGCTGTTTCGGCTTGTACCGGTATGTTTGGGTCGGGTTCTTACCCTGGTTATCCGGGT
CAAACTCTAGTTGATAAGAGTACGGGTGCTAGCTATAATGCGCATGGGGTTAATGGGCGT
AGGTTCTTGCTCCCTGCTATGTGGGACCCAACTAAATCTGCATGCTCGGCACTCGTTTGA
GAAAGAAACAATCAAGAGGGAGATAAGGAGAAGAAAAGAAGAGGGTGGTGGGATTGGGTG
TGGACGAGTCTACGTATGTTCATTGTTCCTTCAGGATTTGGTGGACTGAGGAATTGCAAG
TGTGGGGGTGGGTGGGTGGTTGTCGTTTTGTATGACTGTATATTCCTTTGCTTTTATGTT
TTCTAAAAAATGTGTAAAATGCAATGCCTATAGGACTATAATTAAATAATATGATCCATA
ATAATATTA