Microarray Probes on PGSC0003DMT400032720

Probe IDChipProbe Sequence
CUST_23848_PI426222305 JHI_St_60k_v1 GAATTGACTGAAGAATGCGATGGAACTTCTGATGCAGAGACAGGTAGTGATGAAGACTAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400032720

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400032720 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G58520.1 +1 2e-176 503 245/366 (67%) Ubiquitin carboxyl-terminal hydrolase family protein | chr3:21643921-21645277 REVERSE LENGTH=418

Transcript Sequence (1257 bp)

>PGSC0003DMT400032720 1257 pgsc_dm_v3.4
ATGAATTTGTTAGAAAAATCTCTATTCTCAACCCTAAAATCCATAGCCACCCAAAACATT
GTTTCACATTATCACAATCTTCAGCAACATAGAACCATAGTAAAAGTCCGTTTGAAATGG
GTGAAAAACAGAGGTTTGGACCATATAATCGATGTTCAAACGGACCTTAAAGCAGCTTGT
TTACTTAAAGACGCAATTGTGCGTTCACCAGTTGGGTATCTTACTGCTAAGTCGCTTGCT
GATTCCCAAAAACTTCTTGGGCTTACAGTTCCTACACTTAGGTTTATTAGAAGATACCCA
ACTCTTTTTGAGGAGTTTCCTCACCCGAAGTACCAATCTTTGCCTTGTTTTAAGCTTACC
CAGATTGCTAAAATTCTTCATGATCAAGAATTGAAGGTCTTTGAAGATAACCAGAGTGAT
TTGGTTGAAAGACTTTCCAAAGTTCTTATGATGACAACCAACAGAATGGTGGCGCTGCAA
TCATTGCATCCTTTGAAATGGGATTTAGGATTGCCTGATGATTTCGATAAGAGATTTCCA
GATCATTTTAGGATAGTTAAGGGAACAAATGGGTTGGCTTGCTTAAAGCTTGTTCAGTGG
CCAGAAAAATATGCTGTGTCAGAGTTGCAAAAGATGAATGATGATAGCAGCCCTCTGGCG
GGGTATAGGGAATTTAAAAGGGGCAAAGCTGCATTAGAATTTCCCATGAGTTTCCCAAGG
GGATATGGGGCACAGAAGAAGGTCAAGGCGTGGATGGATGAGTTTCAGAAGCTGCCTTAC
ATCTCACCTTACGAGGATTCAAGGGGAATCGACCCTAATAGTGATCTTATGGAAAAGAGA
GTAGTTGGGGTTTTACATGAGTTCTTGAGCTTGACACTATACAAGAAAACAAAGAGAAAT
TACTTGAGGAGCCTGAGAAAGGAATTATACCTTCCAGATAGATTTACTCGAATATTTACT
AGGTATCCAGGAATATTCTACCTCTCACTCAAGTGCAAGACAACGACTGTGGCATTGAGA
GAGGGGTACCGTCGTGGGAGACTTGTAAATCCACATCCTCTGACACGCCACAGGGATAAG
TTTCATCATGTTATGAGGACTGGCTTAATTTACCGAAGCAAAGGAGTGGACATTTTGCCG
CAGCTGGACAATGTGCTTGATGAAGAAGAGAATGAATTGACCGATGAAGAAGAGATTGAA
TTGACTGAAGAATGCGATGGAACTTCTGATGCAGAGACAGGTAGTGATGAAGACTAG