Microarray Probes on PGSC0003DMT400031742

Probe IDChipProbe Sequence
CUST_10765_PI426222305 JHI_St_60k_v1 GGCTATGGTGTTGTTGTTAGACCAAATGTTCTCCTAAGTGTTGTTTCAATATATGTTGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031742

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031742 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G41590.1 +2 2e-23 93 52/106 (49%) Protein of unknown function (DUF567) | chr5:16632221-16633896 REVERSE LENGTH=221

Transcript Sequence (436 bp)

>PGSC0003DMT400031742 436 pgsc_dm_v3.4
AAAGAAGCCTATATTTTGTGTAAAGAAACAAATGAAGATTTTACATAGTAATATTAATGT
ACTTGCCCATGTTTATTATCATGGAACATCATCAGACAAGACATATTCTTATATTATTGA
AGGGTCATATGCAAACAGAACATGTAAAGTGTTGGATGCAAAATCAAGAAATGTTGTGGC
AGAAATTAGGAAGAAACAAGCAGTAATTGGTGGTGTTACTTTTGGATTAGAAGTTTTTGT
ATTAGTTGTAATGCCAGGATTTGACTCTGGTTTTGCTATGGCTATGGTGTTGTTGTTAGA
CCAAATGTTCTCCTAAGTGTTGTTTCAATATATGTTGATTAATTTTATGTAGTGATCACT
CATTTGAGGAAATGTGATGTTTTCTCTTTATTATATGATCTTGGATAATATATCGTGATC
GTTTGATATATGAGAT