Microarray Probes on PGSC0003DMT400031363

Probe IDChipProbe Sequence
CUST_51519_PI426222305 JHI_St_60k_v1 GGCTTTAATCAACAGTCTTGCTGCCCTTCACGGCTAAAGTAATTTGAAACGACAATTAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031363

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031363 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G62360.1 +1 1e-59 190 105/197 (53%) Plant invertase/pectin methylesterase inhibitor superfamily protein | chr5:25040699-25041310 FORWARD LENGTH=203

Transcript Sequence (725 bp)

>PGSC0003DMT400031363 725 pgsc_dm_v3.4
ATTATCTTTAGTTATTGATACACACACAAAAAAAGAAAAAAAGTTAGAGTAATTAATTTA
AGAGAGATGGAAGGTGGTTATTTTCTCACATATTTTCTTATTTCAATTGCGTTGATAACT
TCTTCTAATAATTGGAATTCAGTTTCCGCCGCAAGGCCATCAGCTGGAGAAACAAATACG
GAGTTTATACGAACATCTTGTAAGTCAACAACTTATCCAAATCTCTGTTTCAGTTCATTA
TCAAGCCGTTCAAATGCTATTGGAGTTTCTCCACAACTTCTAGCACATGAATCTCTCTCC
GTTAGCCTCGAAACAGCACAATCAACATCCGCTATGATGATAAAGTTGTCACACAGTCAA
GGCATGACGCCTAGAGAAGTAGGCGCCATGCGTGACTGTGTGGAGGAATTAAGTGACGCA
GTTAGTGGAATTAAAAAATCTTTAGGGGAAATGAAGGAATTGAGGGGAAAAGATTTTGAT
TTGAAAATGAGTGATATTCAAACATGGGTGAGTGCCGCCTTGACGGACGAGGACACGTGT
ACCGAGGGGTTCGCCGGAAAAGTGATGAACGGGAAAGTTAAGACAGTAGTAAGGGAAAAG
ATACTTGAAGTTGCACATATGACGAGCAATGCTTTGGCTTTAATCAACAGTCTTGCTGCC
CTTCACGGCTAAAGTAATTTGAAACGACAATTAAATATATATACATATTAATGTTTTGAT
CGATC