Microarray Probes on PGSC0003DMT400031270

Probe IDChipProbe Sequence
CUST_52077_PI426222305 JHI_St_60k_v1 ACTTTACAAGAAGGCCATTGGATATGGGAAGGTTGCGAGGGCCTACATTGCATTTTGGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031270

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031270 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G62900.1 +1 3e-23 101 69/224 (31%) CW-type Zinc Finger | chr3:23248868-23254810 REVERSE LENGTH=1465

Transcript Sequence (966 bp)

>PGSC0003DMT400031270 966 pgsc_dm_v3.4
ATGGCGGAAGAACATGAAATTGAAGAGGGAGAAATATATGATGATTCTCATATAGACATT
GATGCTAAGATTCAAACTGTTTTGGGCTGCTGTATCAAAGATTTTGAAGGAGCTGTTTCT
GCTGAGAATTTGGGGCCAAAATTTGGTGTTTATGGTTCGTTTTTGGCGAGTGATCAACTT
GTAATTCAACCACAGATATCTCAAAAACTCCCTTCCCCTACCCCTATTTCTTCTCACAAA
CCCATTAGGATTAGGATTAAGCTTCGTTCTGGTAATACTGCTGCCCCGAAGAGTAGTGAT
TTACACATTGCTTCTGATAAGACACACTGCCCGGAACTGACGACTTGTGGGGATGAGTCA
TCAGTTGCTCCATTCATTATACAAGGAGATTGGATTCGATGTTCTACATGTCGGAAGCGG
AGGCTTCTCCCGTATGGTACAAAACCCGATCAACTGTCTCAGAGTTGGCTCTGCACTATG
TTAGACTGGCTTCCTGGCATGAACTGTTGTGACATTAGCGAGGATGATACCACAACTGCT
CTACATGCCCTCTACCAAACTCTCATCCAAAGTAACTTTCAAAATCGTGGTACTTCAATT
GATGTAAAAGCACATAACGGAAGGGAAGTTTCTGTAAAGAAAAGAAAATCGAGGGAACAA
GACTACTTAGGTAATGACTTGGGTGAAAGTGATGCCAATGCTTTTGAGAGTAAATTCAGA
AAACAGAAGAAGTTGAAGGTGATTCAGACTGAAAAAAATAAGTCCAGTAGAAGCAAGGGT
GAAGGGAAATCGACAAGGAGAGATACAGGAATCAAGGATTCTGCTCCGATAGAGAGAGAA
GACCAGACGAACAAGTATAGAGTAAAGCATCAATCCGAAGCAGAATCTGGCATGATCCGC
AAGCCACTTTACAAGAAGGCCATTGGATATGGGAAGGTTGCGAGGGCCTACATTGCATTT
TGGTAG