Microarray Probes on PGSC0003DMT400031261

Probe IDChipProbe Sequence
CUST_6983_PI426222305 JHI_St_60k_v1 TATGCATTGCATTGCTCATCAACAACTGGTAATGTGATGCATAGCTTCTCATGGGGTGGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031261

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031261 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G67710.1 +3 5e-124 380 267/583 (46%) response regulator 11 | chr1:25376994-25378905 REVERSE LENGTH=521

Transcript Sequence (1887 bp)

>PGSC0003DMT400031261 1887 pgsc_dm_v3.4
GATCTACTCCTGTCTTCCCCAAGAATCTGGCTGTTTTTATGATGGAGAATAGTAAAACCA
GTGCTGGGTTTTCTTCCCCAAGAACTGATACTTTTCCAGCTGGTTTAAGGGTTCTTGTTG
TTGATGATGATCCTACTTGGTTGAAGATTCTTGAAAAAATGCTTAAGAAGTGTTCTTATC
AAGTGACAACATGTGGTCTAGCACGAGAGGCTTTGCATGTGCTCCGAGAGAGAAAGGATG
GATTTGACATTGTGATCAGTGATGTTAACATGCCTGACATGGATGGATTTAAGCTTTTGG
AGCATGTTGGACTTGAGATGGATCTTCCTGTCATTATGATGTCTGTGGATGGTGAAACAA
GCAGGGTGATGAAGGGTGTTCAACATCGTGCATGCGATTATCTTTTAAAGCCTATACGGA
TGAAAGAACTTAGAAACATATGGCAGCATGTACTCAGAAAAAAGATGCAGGAGGCAAGGG
ATGCTGGAAATCATGAATTGGACCAATATGATGAAGTGTGGATGCTTAATGGAGCTGAAA
TCCTTTCAGGAAAGAAAAGAAAAGATTTTGAGAATAAGCATGATGAAATAGAAATGTCCG
ATTCAAGATTTGTTGATTCTTCTTCCATGAAGAAAGCCAGAGTCGTTTGGACTGTAGATC
TTCATCAGAAATTTGTCAAAGCTGTAAACCATATTGGATTTGACAAAGTTGGTCCCAAGA
AGATTCTTGATTTGATGGGTGTCCCATGGTTGACTAGAGAAAATGTTGCTAGCCACTTAC
AGAAGTATCGCCTCTACTTGACTAGGTTGCAGAAAGAAGATGAAGCTAAAGACTCATTTG
GTGGGATGAAGCATCCGGATGTTTCTTCTCAAGAAATTTGTTCGAGTCTCAGCCTTCAGA
ATCCAGTGGATGTGTACACTGATGTTACAAATGACAAGTATGTTTGTGTTTCTGGAGACA
AAGCTATTGTTCAAAATGGGAAATCCAACATATATGAGAGCAAGGTAAAGGGTGTTGTTT
CAGTGCCAGCTGCTGAGGCAAAGTCTGTGATTGAAGATAACTTTGATTCTCAGACTGCTG
GTTCAAAGATAGGCCTCAAGGATTCCTTTGGATTGGTCAATACTGATGTAAAAAGTTCTA
AGGTACCCACTCCATACTGCTCTACTGGAGAAGCTCCACAACCTCAATACAAGCAGCAAG
ACTTTAAACCACATTTTCAGTCAGCTAATGGGTTAAGTCACCAGCCACTGCCTGTGGTTT
CTCATCAAATCCCAGTTGATCGCACACAAGTGACTTGTTTTGTCAACCATATACCTTCTC
ATGAAGAAAGGGACAGACATCCAGATACAAGAAATAAACCTTCTTTCTTCAAGACCAAAA
ATGGAGTAGGAAAGTTTTCTCCAGTAGAAAGTAATGTTAACTTGTTTCAACCTGTGAGCC
ATCAACAAACAAATTTTCATACTCTTGAGCAAATGCCAAGTACTACATGGAGAGCGACGA
GTCACAATGTAGTCAATGGTTCACAATCAAGCCTGGGAAATCTAACTTTGAGAAGTGGTT
CAATTGTTGCATCTGTAGGTGAGGAGATTTTTGGTGCTTCTGTTCAAGGGGAATGTTTTC
TAGCTAATAATGGTCTTCCGAACATTGAACAATTTGACTACAATGATCCACAACCCATTT
CTGGAGTTCCAACATACTTGTATGATACATTGAGGTTTGATTATGAGTATCCAATTGATT
CATTGGAAGGTAATATGATGGACCAAGGTCTGTTCATAGTCTAACCTTTATCCCATGGGA
AGCTTTAGATGGTAGACAATATATGCATTGCATTGCTCATCAACAACTGGTAATGTGATG
CATAGCTTCTCATGGGGTGGGGTGGGG