Microarray Probes on PGSC0003DMT400031202

Probe IDChipProbe Sequence
CUST_51086_PI426222305 JHI_St_60k_v1 GTTGTCTCTTTCTTTTTTCGTTGTGTTTTTGGGAGTTTTGTATCGAAATTTCACGATTGG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031202

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031202 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G38540.1 +2 2e-24 96 55/118 (47%) lipid transfer protein 1 | chr2:16130418-16130893 FORWARD LENGTH=118

Transcript Sequence (702 bp)

>PGSC0003DMT400031202 702 pgsc_dm_v3.4
TAAAAATCCAAAGATCTCACTATCTTTTGCACCCATCACTCAAACAAAACACATTTCCTC
ATACTACTCTTTACTATCATTTTATCCTCTCTATTTTTCATTATTATTAACAATGGAAAT
GGTTAGCAAGATTGCATGTTTTGTGGTTTTGTGTATGGTGGTGATTGCACCCCATGCAGA
GGCATTAACTTGTGGTCAAGTTACAGCTGGCCTGGCTCCTTGCCTCCCTTATCTTCAAGG
CCGCGGCCCTCTAGGAGGCTGTTGCGGTGGTGTTAAGGGTCTGTTGGGTTCAGCCAAGAC
TACCGCGGATCGAAAGACAGCATGCACTTGCTTGAAATCAGCCGCTAATGCTATAAAGGG
AATTGATTTGAACAAAGCTGCCGGTATCCCTAGTGTTTGTGGAGTCAACATTCCTTACAA
GATCAGCCCCTCCACTGACTGTTCCACGGTTCAGTAAGGTAGATCATCAGAATATGGAAC
CATGAGGAGAATTAAGAATAAGATGAATGGAGTGTGATCCTGCTTATGGATCCATTATTT
ATGTGTTGTGTCTGTTGTCTCTTTCTTTTTTCGTTGTGTTTTTGGGAGTTTTGTATCGAA
ATTTCACGATTGGTTGTATTACGTTAATCCAATCTTGATAATATATCTATCTTATTTAGT
ATGTCTCTTGTGTACTCGATATACTTTCCTTTTCTCTATTCT