Microarray Probes on PGSC0003DMT400031199

Probe IDChipProbe Sequence
CUST_51087_PI426222305 JHI_St_60k_v1 CTTGTAATGAACATTGGTGGTTGCTTGTGTTACAACCCAATCTTCATATAGTAATACATG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400031199

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400031199 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G38540.1 +3 1e-23 94 57/113 (50%) lipid transfer protein 1 | chr2:16130418-16130893 FORWARD LENGTH=118

Transcript Sequence (682 bp)

>PGSC0003DMT400031199 682 pgsc_dm_v3.4
TAGCTTTTGCACACAACACTCAAAACAAATACATTTGTAGTACTATATCATCCTCTACTA
TTTCTATCGATCTTTACTCAATTTTTGTAACAATGGAAATGTTTGGCAAAATTGCATGCT
TTGTGCTTTTGTGCATGGTGGTGGTTGCACCCCATGCAGAGGCACTGAGCTGCGGCGAGG
TTACATCTGGCTTGGCTCCTTGCCTCCCTTATCTTCAAGGAAGCGGTCCTATCGGAGGGT
GTTGTGGTGGTGTTAAGGGTCTTTTGGGTGCAGCCAAGACCCCAGAAGACCGGAAAACAG
CATGCACTTGCCTTAAGTCGGCAGCTAATTCTATTAAGGGAATTGATACGGGAAAAGCCG
CTGGTCTCCCTGGAGTTTGTGGAGTCAGCATTCCTTACAAGATCAGCCCTTCCACTGATT
GCTCCAAGGTCCAGTAAGGTTGATGAAATTAAAGATAAGTCTATATATAGCTTGCAGAGA
TGAAGAATAAGATGGATATATATCGATCGAGTTTGATCCATCATTATATATGTTGTCTCT
TTTCTTTTGTATTTGTGTCTGTTGGAGTACTTATATATTGTAGTCTTGTAATGAACATTG
GTGGTTGCTTGTGTTACAACCCAATCTTCATATAGTAATACATGATATTTTCTTCTTTAA
ACTTTTCTTAACTATTAATTAT