Microarray Probes on PGSC0003DMT400030982

Probe IDChipProbe Sequence
CUST_51076_PI426222305 JHI_St_60k_v1 CGTTATGTATGCTAACAGTGTAAATATTAAGTCCTGGTGAAGTAATGAACAAAGTCTGAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030982

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030982 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G35710.1 +2 0.0 634 307/438 (70%) Nucleotide-diphospho-sugar transferases superfamily protein | chr2:15010925-15014070 REVERSE LENGTH=497

Transcript Sequence (2072 bp)

>PGSC0003DMT400030982 2072 pgsc_dm_v3.4
TATAAAAAGCTGTTCATTTCCATAAACTCCTTCAACTTTATTCCATACTCTTCTATTTAT
CAGCTCCTAGATCTTCTTTTTTGTTGTTGATATTCTTTTAAAAATTGTTCAGTTGATCAA
AGCTAAGACACAGGGACTGCGGCCATTGTTTCACCGGAATCTTCTTTTTTTCCCGGTGAA
AGTTTGAACGCACACCGTTATTTCTAGCTAGAAGTACTAGACAGTAGACAATGTCATGTG
AAAAACATCACAAGTTTTTGAAGATTTGTAATTAATTAGTTGAGATTTTTAATTTGGAGG
AAAGAGAAAAACAGAGAAGATGATAGGGCGGGTGGACTTGTTGTTGGTATTGTTGATAGC
AACGACGGCGACTATTGGGGCTGAAACGACGACGTTAAAAGGGGTAAACAGAAATGCGTA
TGCGACTATGATGTATATGGGAACTCCGAGGGACTACGAGTTCTACGTGGCGACTCGAGT
AATGCTCCGATCACTTACCCGGCTAGGAGTTGAAGCCGATCTCGTCGTTATTGCTTCACT
TGACGTTCCTCTTCGCTGGGTTCAAACTCTAGAACAGGAAGATGGTGCTAAGGTGGTGAG
AGTTAAAAATCTGAACAATCCGTATTGTATCAACCCTAATTGGAGATTCAAGCTCACACT
GAACAAACTTTATGCGTGGAGCCTCGTAAATTATGACAGGGTTGTCATGCTTGATGCTGA
CAACCTTTTCCTCCAGAAAACTGATGAACTGTTCCAATGTGGCCAGTTTTGTGCTGTCTT
CATTAATCCCTGCATCTTCCACACTGGTCTCTTTGTATTGCAGCCATCAAAAAAGGTGTT
CAATGACATGATCCATGAGATAGAGATTGGGAGGGAAAATCAAGATGGTGCAGACCAAGG
TTTTATTGGAGGCCACTTCCCAGATTTACTTGATCGGCCAATGTTCCACCCTCCTCTTAA
TGGTACCCAGCTCCAGGGAAGTTACAGGCTTCCTCTAGGATACCAAATGGACGCATCTTA
TTATTATCTCAAACTCCATTGGTCGGTACCTTGTGGACCTAATAGTGTCATTACATTTCC
CGGTGCTCCATGGTTAAAACCATGGTATTGGTGGTCATGGCCTGTCTTACCCTTGGGCAT
CCAGTGGCATGAACAGCGACGTCTAACTGTTGGGTATGGTGCTGAGATGATAGCAGTGTT
GATCCAATCTATATTTTACCTAGGAATAATTGCAGTGACACGCCTCGCACGCCCAAATTT
ATCAAAGTTGTGCTATCGCCATGATGATAGCAAGAGTGCCTTCTTACTACGAACTGGCCT
TAAATTGATTGCTATATGGTCCATTCTTGCTGCCTACACAGTTCCTTTCTTCGTGATTCC
TTGTACAGTTCATCCACTAGTTGGCTGGAGTCTCTACTTACTCGGCTCTTTTTCACTATC
CTGTATAACAGTGAATGCATTTCTTTTGCCGATGCTACCTGTTTTAGTCCCATGGGTTGG
AATCCTTGGGGTCCTTTTGGTGATGGCTTACCCTTGGTACAACGACGGTGTTGTAAGAGC
AATGGCTGTATTTACATACGCCTTCTGTGCTTCTCCAGCATTATGGATGGCATTGGTTAA
AATCAAGTGTTCTCTTCATGTTTCACTTGAGAGGGAAGGATTCTTGCCCAAGATAAGTGA
ATCTACAGCACCTGCTGGTTCTAACAAACTGTATTGAAAGTCAAAAAGTTGAAGGAATCA
ACAGGAGAACTAATGCTTCAGAAACATCTCCAAACGTTTTGCTTAGCAGACTTGGGGTCT
GCTTGTGCCATCCTAGCTAGCTGCTTCAGTCTGTGCTCTTAATTAGAAAGGAATTCTGTG
AGTGGGTTTAGAATTGGGAAGATGTTTTGTGTTATACATGGACTATCTCTGGTCTCTTGA
CTGCTACTCCACGAAAAAGATTGTTTCACTTGATTATTTCTGTTGCTACAATGTATGTTG
AATAGGTTCTTTAAAATTTATTCATGGATTTACGTTATGTATGCTAACAGTGTAAATATT
AAGTCCTGGTGAAGTAATGAACAAAGTCTGAG