Microarray Probes on PGSC0003DMT400030744

Probe IDChipProbe Sequence
CUST_47522_PI426222305 JHI_St_60k_v1 GTATGCACCATTGGACAAAGCATTTGGAGCAAATGTGGAAACATTTTGCATCTTTATATT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030744

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030744 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G14520.1 +2 8e-66 164 96/255 (38%) Terpenoid cyclases/Protein prenyltransferases superfamily protein | chr3:4875868-4878243 REVERSE LENGTH=605

Transcript Sequence (1519 bp)

>PGSC0003DMT400030744 1519 pgsc_dm_v3.4
ATTATTAAGTTTGTACGAAGCAGCACAAATGAGAGTGCGCGGGGAGGATATTCTCGAAGA
AGCTCTTACTTTTACCACTACTCATCTCGAGTCCATGATCCCCATGTTGAGCAATAATCC
ACTTAAGGTTCAAATTATTGAAGCCTTAAACCACCCTATACACAAAGTTATGCCAAGGTT
GGGAGCAAGAAAATACATAGACATTTATGAAAACATGGAATCACACAACCATTTGCTTTT
AAAATTTTCCAAATTGGACTTTAACATGTTGCAAAAGCAACATCAAAGAGAGCTTAGCGA
GCTTACAAGCTGGTGGAAAGATCTGGATCTTGCAAGCAAAGTGCCATATGCAAGAGACAA
ATTAATTGAGGGTTACACATGGACATTGGGATTGTATTTCGAGCCTCGGTATAGTCGTGC
AAGAAGAATGTTAGTAAAAGTATTCAAAATGCTCTCAATATGTGATGACACTTATGATGC
ATATGCAACTTTTGATGAACTTGTGCTTTTCACCAATGCAATACAGAGGTAATTGATGAG
TAGGAGAAATTAAACATTTTAATGACATACAATAATAGTTGATACAAATTTTTTGATGCA
TAGATGGGACATAAACGCCATGGATTCATTACCGCCATATATGAGACCTTTTTATCAAGC
CATTCTGGATATCTTCGATGAAATGGAGGAAGAATTGACCAAAGAAGGTAAATCAGACCG
CGTTTACTATGGTAAATTTGAGGTAATCCTCGCTTTCTTTGCCTCATTAATCGATTAAAC
TTGTAAATTCTAGAGAAATAACAAAAATATTGGCATGAAAAATGCATACTTATGGTATGT
CGTGCTATTTTTGTGTTTTCGTTTTAGATGAAAAAGTTGGCTAGGGCCTATTTTAAAGAA
GCGCAATGGTTAAATGCTGGCTATATTCCAAATTGTGACGAGTATATAAAAAATGCAGTT
GTAAGCACTACCTTTATGGCGCTTGGAACAGCTTCTTTGATTGGTATGGAGGAATTCATG
ATAACAAAAGACATTTTTGAATGGATAAAAAATGAGCCTTCGATTCTTCGAGCTTCATCA
ACTATCTGCAGATTAATGGACGATATTAGTGATCATGAAACTGACCAACAAAGAGGACAT
GTAGCTTCTGTCATTGAATGCTATATGAACGAATATGGAGCTTCAAAGCAAGAGGCCTAT
GTTAAGTTTCGGAAGGAAGTCAAGAATGCATGGAAAGACATAAACAAGGCATTACTACGC
CCTATTGAAGTACCAATATTTGTTCTCGAACGAATTTTAAATCTTGCACGGACAATGGAT
ACTTTTTTCCAAGATGAAGAAGATGGATATACAAATTCCAATTCCAAATGTAAAGACATT
ATTACCTTGTTGCTTGTTGATTCTGTTACTATATGACGATCATAATGTGTATGCACCATT
GGACAAAGCATTTGGAGCAAATGTGGAAACATTTTGCATCTTTATATTTATAATTAATTG
GTTTATGTTTGCTTTCAGA