Microarray Probes on PGSC0003DMT400030682

Probe IDChipProbe Sequence
CUST_34170_PI426222305 JHI_St_60k_v1 TATCAAATGGCTAAGATTTCTCGTCTTATTGGATCCACCGTCAAAGCAGCTATCACCGCC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030682

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030682 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT3G22200.2 +3 0.0 751 381/501 (76%) Pyridoxal phosphate (PLP)-dependent transferases superfamily protein | chr3:7835457-7838863 FORWARD LENGTH=513

Transcript Sequence (2212 bp)

>PGSC0003DMT400030682 2212 pgsc_dm_v3.4
ATGGGTACGGAGGAAGTTAGTAGTGCTTTTTATATGACTTATTCGTGATTATTAAAACTG
ATAAGATGTGGTGTCATCACTGAGTTGGAGTCCGTCTAATTTTTTTTTTTCTCTCTCTTG
CCTGGCGTCTTTTGTTTTTCTCTATATATATTGCACCTTCATCTTTTTTTCTTTTGCATG
TTTTATTTTTACGATATTTGATTTGCAATTTAGCAACGAATTGATTCGAAGGATCATATC
AAATGGCTAAGATTTCTCGTCTTATTGGATCCACCGTCAAAGCAGCTATCACCGCCCAGG
CTGGTTTCCATGCAAAACGTATTCCAGCAGTTAGCAGTTTACAGGAGCATATAGTTAAAT
CAACACCGGCAAGATATAGTAGTACACAGGCATGTTTGGAAAATGACATTTCTGGAACTG
ATAATAAAGGGTTCAAGGGTCATGATATGTTGGCACCCTTCACTGCTGGGTGGCAAAGTA
CTGATGTGGATCCTTTAATTATAGAGAAGTCTGAGGGATCCCACGTATATGACATGCAAG
GGAGGAAGTATCTTGATACTCTAGCTGGTTTGTGGTGCACAGCACTAGGGGGGAACGAGC
CTCGCCTGGTTGATGCTGCCACTAAGCAATTAAACACATTGCCATTTTACCATTCATTTT
GGAACCGTACAACAAAACCTTCTTTGGATCTTGCGAAGGAGCTTCTGGATATGTTTACTG
CAAAGAAAATGGCAAAAGCTTTTTTCACCAATAGTGGATCAGAAGCCAATGATACCCAGG
TGAAGCTGGTTTGGTATTATAACAATGCTCTTGGAAGGCCAAACAAAAAGAAATTTATAG
CTCGAGCAAAAGCATATCATGGTTCAACTCTTATTTCTGCCAGTCTCACTGGTCTTCCTG
CATTACATCAAAATTTTGATCTTCCTGCTCCATTTGTTCTTCACACCGACTGTCCTCATT
ATTGGCGTTATCATCTGCCAGGTGAGACAGAGGAGGAGTTCTCTACCAGATTGGCTAAAA
ATTTGGAAGATCTTATCCTCAAAGAGGGGCCTGAAACAATAGCTGCTTTCATTGCTGAAC
CAGTCATGGGGGCAGGAGGTGTCATACCTCCTCCAGCTACCTATTTTGATAAGATTCAAG
CTGTAGTGAAGAAATATGACATTCTTTTCATTGCGGATGAGGTGATCTGTGCCTTTGGGA
GGCTTGGAACAATGTTTGGCTCTGACATGTATAACATCAAACCTGATCTTGTCTCCTTAG
CAAAGGCTCTTTCTTCTGCATATATGCCAATTGGAGCTGTCCTTGTAAGCCCTGAAGTTT
CTGATGTAATTCATTCTCAAAGCAATAAACTTGGTTCCTTTTCCCATGGATTCACTTATT
CTGGGCATCCTGTTGCATGCGCGGTGGCATTGGAAGCTATTAAAATCTACAAGGAGCGAA
ATATGGTTGAGAGAGTAAATACAATATCCCCAAAGTTTCAAGAAGGTCTGAAGGAGTTTT
CTGACAGTCCCATTATCGGAGAGATTAGGGGAATTGGTTTGATCCTTGCCACAGAGTTTG
CGAATAACAAATCTCCTAATGATCCTTTCCCTCCTGAATGGGGTACGTAATTTTCCTCAT
CATTTGCTCTTCAATTGAAGGTCACATTAAACTCTTATCGTCTCATTGCTGCCTCAGGTG
TTGGTGCATATTTTGGAGCGCAATGTCAGAAGAATGGCATGTTGGTACGTGTTGCTGGTG
ATACCATCATGATGTCTCCTCCATTTGTAGTTACTCCAGAAGAACTTGACGAGTTGATTA
GCATCTATGGGAAAGCATTGAGGGAAACTGAAAAGAGAGTAGAAGAACTCAAGTCTCAGA
AGTGATATTAGTTGACAGTACAAGCTTGACGATGACGAAAAAAACAAAAACAAATTCAAG
CACAATAAAATAAAATCAAATGTGTTGGATATTCTGTAAATGTCCAGAATGAAGTAATGA
GTATAATTTTTAGTCCAAGTTGCTCCTCTTCTCTTTCATTTTACATGCAGTATAGTTTCA
CCAGTTCACTTATTGATGAAGATGTCTATCCCCTTAACCAGTTGTCACCCAAGATTAATG
CATTTTACCAAAAAATAGAATTTATTAATCTATGTTCTTGTAATTAATTGAGTTTTTTTA
TGTTCGAGTTTGTACGTTAATGCACATTTCTCCTATAAAGTCTTTTCTGTCA