Microarray Probes on PGSC0003DMT400030514

Probe IDChipProbe Sequence
CUST_28982_PI426222305 JHI_St_60k_v1 CGAGAGAACGAATTAAGGCAACGTGAATTGTCAATCTTTCATAGAAATTTCATTTGTGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030514

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030514 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G47710.1 +2 7e-96 303 155/261 (59%) Serine protease inhibitor (SERPIN) family protein | chr1:17558271-17560061 FORWARD LENGTH=391

Transcript Sequence (1901 bp)

>PGSC0003DMT400030514 1901 pgsc_dm_v3.4
TGATCATTCATTCTACTCACTAAGCCTCCTTCTTCCTCTTCATCTTGTTCGTGTGCAAAT
ATGGATCTTCACGAGTCAATCACCAGCCAGACGGATATTTCTTTCATGCTTGCTAAGCAT
GTTTTCTCCAACGTAGTTAAAGGCGATACCAACCTGGTGCTTTCTCCTCTCTCAATTCAA
ATTGTTCTTGGCCTTATTGCTGCTGGCTCTGATGGACCTACTCAGGATCAGCTTCTCTGT
TTCCTCAAGTCCAAATCCATTGATGAGCTCAACTCTCTTTATTCACATATTACCAATGTA
GTCTTTCGTGATGGCAGCCCCAATGGAGGTTTGCGATTGTCCGTTGCTAATGGCATTTGG
ATCGATCAAACGCTGCCTTTAAAACCGTCTTTCAAGCAGGTCGTGGATAATGTTTACAAG
GCGGCTTCAGAGTATGTTGATTTTCAAAACAAGGTTAGGCCTTAATCTTTCGTTCAAATA
TTACTCTCTCCGCTTCAATTTGTTTGTCTAACATTTTAAGCCTCTAAACGAAGGGAGCCT
TGGTGTGGCTGGTAAAGTTGTTGTCGTGTGACCAGGAGGTCATCAGATCAATCTGTGAAA
ACAATTTCTTGCAGAAATGCAAGATACAGCTGCGTGAAATAGACTCGTATGGTCTAGCCT
TTCACTGTACCATGCGCATCAGGGGAGCTTAGTGCACCGATTTCCCTTTTATAAGCCTCC
AACGTTATGTGAATTGAGTACAAATGACTGCAATTACTAATATGAAATGTCTAATACGTA
CAAATGACTGCAATTACTAATATGAAATGTCTAATACGTACAAATGACTGCAATTACTAA
TATGAAATGTCTAATTCTACTATTCCATGTTTGTCTTGCCAATTTGATTAAGGCTGCTGA
GGTTGTCGATCAAGTCAACCAGTGGACTAAAATGAAGACAAATGGTCTCATCGAACACAT
TCTTGATCGTGATGCAGTGGACAACATGACAAGGCTGATCTTGGCCAATGCACTATATTT
CAAAGGTGAATGGAATGAGAAGTTCGATGCTTCAGAAACAAATGACCACGAGTTCCATCT
CCTCGATGGGTTGCCTATTCGAGTACCCTTCATGAGTAGCAAGAAAAAGCAGTACATAGC
AGCATTTAATGGCTTTAAAGTATTGAGGCTTCCTTATAAACAGGGAACAGATACGCGTTG
CTTCTCAATGTACTTCATTCTTCCAGATGCACATGATGGATTACCCGCTTTATTTGGCAA
AATCAGTACAGAACCTGGATTCTTAAATCACCACGTTCCGTTAAGAAAAGTTAGTGTGGG
CAAGTTTCTTATCCCTAAATTCAAAATAACTTTCAAGTTTGAAGCTTCCGACATTCTAAA
GGGACTTGGCCTAACGTTACCTTTCTGCGGTGGTGGTCTCACTGAGATGGTTGATTCTAC
TTTACCTGAGAATCTATCTGTTTCAAAAGTTTTTCACAAGTCCTTCATTGAGGTAAATGA
GGAAGGCACCGAAGCTGCAGCTGTTACGGTTACTCTAATAATGCCATTGTCCTTGTTTAT
TGAGAAGGAAATCGACTTTGTTGCTGATCATTCATTCCTGTTCCTTATAAAAGATGAATC
TACTGGTGTCGTATTGTTCCTTGGGACTGTAATGAATCCTCTAGCTGGTTAGCCCTACTC
AACCAACAAAGAAGAGTGAAGTGGTGAAAACACTCCAAACTTGACGTGAATCATTACTTT
CGTCCATGATGCCTAGTACTAATTAAAACACCCCTAGGCTTGACTAACGTAATAATTCAT
GTCAAGTTTGTTTTAAGTTTGAGTTTCGAGAGAACGAATTAAGGCAACGTGAATTGTCAA
TCTTTCATAGAAATTTCATTTGTGCTTAATTTGTTTGTTCA