Microarray Probes on PGSC0003DMT400030495

Probe IDChipProbe Sequence
CUST_29097_PI426222305 JHI_St_60k_v1 TGTTAGATAAGACTGCGTATAATAAGCTCTTGTGGTTCGACCGTTTTAGTGCATCTGGCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030495

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030495 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G25900.1 +3 4e-31 116 56/86 (65%) GA requiring 3 | chr5:9036073-9038278 FORWARD LENGTH=509

Transcript Sequence (426 bp)

>PGSC0003DMT400030495 426 pgsc_dm_v3.4
GTCCTGAAGAGTGGAAGCCTGAACGATTTCTTAACGGAAAGTATGATCCAATGGAATTGC
AGAAGACAATGGCGTTCGGGGCTGGAAAAAGGGTATGTGCTGGTGCTCAGCAAGCAATGA
CAATTAGCTGCACAGCTATAGCTAGATTGATACAAGAGTTTGAATGGAGCTTAAAAGAGG
GAGAAGAGGAAAATGTTGCAACAATAGGTCTTACTACTCATAAACTTCACCCAATGCTAG
CTCATATCAAGCCAAGAAATTGAAAGGGAGTCTTTAATTAGCGTAACAGGTAAATTTATT
GTCATGTGATCAGGAGGTCACGGGTTCAGACCATGGGAATAGTCTCATCACTCCTGCAGA
AATGTTAGATAAGACTGCGTATAATAAGCTCTTGTGGTTCGACCGTTTTAGTGCATCTGG
CTGCCC