Microarray Probes on PGSC0003DMT400030478

Probe IDChipProbe Sequence
CUST_24199_PI426222305 JHI_St_60k_v1 TGGATACTCTGAAGGAGCGCCATGGTCCTGCGTTGTTTCATTTCCATGTTTGTTGAAAAC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030478

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030478 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G08750.1 +2 9e-18 79 46/101 (46%) Peptidase C13 family | chr1:2801283-2804392 FORWARD LENGTH=388

Transcript Sequence (433 bp)

>PGSC0003DMT400030478 433 pgsc_dm_v3.4
GGTACCCGTGACAAACTTTTTTGGTTCAGTCATGGAGACGATACACAGTGATTCTGCATA
TAAAGCATTCGCTGGCAAAGACTCCAAGAAGTCTACATAAGAGATGCCTCTTCGGCAGTC
CAGCCAAGACTTACGACGAACACTTGCAAGTTCAGATGTTCAGTATCCAACTAGTGACTC
AAATGTTGAGGATCAACAAGATTCCTGTCCTTTCACAAACTTTTGGATTTCTATGCATGG
TAAAATGAGCAAGGTTGAGGGTCTTGATAGCTGGGTGAACTATGGCTTGTTTTTTATGTT
TCCAATGGTGGCAATGTCTTCTTGGATCTCGTCTTGAAGTTTCAGAAGTGGAGACAAGAC
ATCAAATGGATACTCTGAAGGAGCGCCATGGTCCTGCGTTGTTTCATTTCCATGTTTGTT
GAAAACGTTGGCC