Microarray Probes on PGSC0003DMT400030402

Probe IDChipProbe Sequence
CUST_47116_PI426222305 JHI_St_60k_v1 GTGTGTGTGTTTTAAGTGTGGAAAATGCCTATTTTGAGTTTGAGACGTGTGATTTTGTTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400030402

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400030402 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G05340.1 +1 1e-166 474 234/298 (79%) Peroxidase superfamily protein | chr5:1579142-1580819 REVERSE LENGTH=324

Transcript Sequence (1251 bp)

>PGSC0003DMT400030402 1251 pgsc_dm_v3.4
CTTTATTCTTCTCTATTTTTATTATATTTTCCACTCTCTAAATATTAGTCAACTTTTGTA
ATGGCTTCTTCAAAAAATAATACTATGGTTTTTTTATTTTTGCTTGTGACCTTACTAATT
GGAAGTTCATCAGCACAACTTTCAACTAGTTTTTACTCAAAATCATGTCCTAAGCTTTAT
CAAACTGTGAAATCAACAGTGCAATCAGCTATCAAAAAAGAAACCCGAATGGGCGCTTCG
CTTCTTAGGCTTTTCTTCCATGATTGCTTCGTTAACGGATGTGATGGATCACTACTCCTT
GATGACACATCAAGCTTTACTGGAGAAAAAAGGGCTGCTCCAAATGTGAATTCTGTAAGA
GGATTTGAAGTCATTGACAACATCAAATCTGCTGTAGAAAAAGCATGCCCCGGCGTTGTT
TCTTGTGCTGATATTTTAGCTGTTACGGCTCGTGATTCTGTTGTCATTCTTGGAGGGCCT
AATTGGAATGTAAAATTGGGCAGAAGAGATGCCAGGACTGCAAGCCAAGGTGCTGCCAAC
AGCAGCATTCCAGCTCCTACTTTTAACCTAAATAGACTCATCTCAAGTTTTAGTGCTGTT
GGCCTTTCTACCAAGGATATGGTTGCCTTATCTGGTTCTCACACAATTGGACAAGCAAGA
TGCACAACATTTAGGGCACGTATATACAATGAGACCAACAGCATAGATTCATCATTTGCA
AGAACAAGGCAAAATAGTTGTCCAAGAAACTCAGGCTCAGGTGACAACAACTTAGCGCCT
CTAGATCTTCAAACACCTTCGAAATTCGATAACAATTACTTCAAGAATCTTGTGAATAAA
AAGGGTCTTCTACATTCCGATCAACAATTATTCAATGGGGGATCTGCTGATTCGATCGTT
AGGTCTTACATCAATAATCCTAGTAGTTTCAACTCTGATTTTGTGACTGCTATGATCAAG
ATGGGCGATATTCGTCCACTTACTGGATCGAATGGTGAAATTAGGAAGAACTGCCGTAGA
AGAAATTAAGTGTTGAATATTGGTATTAAGTGTGTGTGTGTGTGTGTTTTAAGTGTGGAA
AATGCCTATTTTGAGTTTGAGACGTGTGATTTTGTTTTACTCTATAGTTTAATTAGTCAA
AGTTTTCTTTCTTAATATGATGATAGTTCAATGTGTGTTAAAGGCGTAAAGCATTTTGTA
TTTGTATCACTATTGGAATATTATGAATAACTTAAACACACTTTTTGTTAG