Microarray Probes on PGSC0003DMT400029949

Probe IDChipProbe Sequence
CUST_40535_PI426222305 JHI_St_60k_v1 TGTGGTATCTTGAAAACTACTCGATACAACCTAACGATACATCCAATACCAATGATTGTG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400029949

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400029949 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G08630.1 +1 5e-180 518 250/354 (71%) threonine aldolase 1 | chr1:2743948-2745685 REVERSE LENGTH=358

Transcript Sequence (1843 bp)

>PGSC0003DMT400029949 1843 pgsc_dm_v3.4
CTTGAAATTTGTGGCTTAGAAGACAGACACCCATTGAGTTAGGAAGTGAAAAAAAATTTG
AGTGAATTGTCTCTCTAGCATTGCTTGTATTGAAGAAACAGAGAAGAGAAGCTTATAAAT
TCAGTGAAGATGGTGGTAAGAACTGTGGATCTTCGCTCAGACACAGTCACTAAACCAACT
GAAGCCATGCGGAACGCTATGGCCAATGCTGAAGTGGATGATGATGTCTTGGGTTATGAT
CCAACAGCCCAACGCCTTGAAGCAGAGATGGCAAGGATAACGGGCAAAGAAGCAGGATTA
TTTGTTCCTTCAGGCACTATGGGTAACCTTATCAGTGTGCTGACTCATTGCCAAATCAGG
GGCAGTGAGATTATTCTCGGTGATTATTCCCATATCCATATTTATGAAAATGGAGGCATT
TCCACCCTTGGAGGTGTTCATCCAAGGACAGTGAAGAACAATGAAGATGGTACAATGGAT
CTTGATCTGATTGAAGCTGCGATTCGAGATCCTAGCTTTGAAATATGTTACCCAACCACT
AGGCTGATCTGCTTGGAGAATTCGCAAGCTCACTCAGGGGGCAGATGCCTTTCTGCGGAG
TACACAGACAAAGTCGGAGAGCTAGCAAAGAAGTATGGTCTGAAGCTTCACATTGATGGA
GCTCGTATATTCAATGCATCAGTTGCACTTGGAGTGCCTGTTCATAGGCTTGTACAGGCT
GCTGATTCAGTTTCGGTATGCTTATCAAAAGGTCTTGGTGCTCCAGTTGGATCTGTGGTT
GTTGGTTCGAAGAGTTTCATTGCCAGGGCCAAAATCCTGAGGAAGACTCTAGGCGGTGGG
ATGAGGCAAATTGGTGTCCTTTGCGCTGCTGCTTTTACCGCTTTACAAGAGAATCTTGTT
AAGCTGGAAGGAGATCACAGAAAGGCAAAGAGTTTGGCTGCGGAACTTAACAAAATCAAA
GGGCTTAAAGTTGATGTTGCTACTGTAGAGACTAACATTGTATATTGCGATATACTGAAG
GGGTCAAGGATCAGCGAAACAGAATTGGTCAAGACTTTGGAACAATATGGTTTACTTATA
CTACCAGAAGGCCCACTGAGAGTCAGATTTGTTCTACACCACCAGATTTCAGAAAGTGAT
GTACACTATGCAGTGTCTTGCCTTCAGCGAGCTTTAGCAGGAGTGGCTGAAGAAAATGGT
GACAAGTAACCGGATAAACGGTTTCAGACATGATCTCTTTCTGTTAGAAACTGTCCAAAT
GTTACATGGGAGAGACCAGTTTCATTTGCAGATTTTAGTCTAAATCTTTTAACTTTTCAT
TTCATGTCCTTTTAATGATCAAAAGACTGTTTGTTCTTCATATGTTTGTGGTTGAACTAG
TTTTAAAATTTATCCTAATGATTTAGTAAGAGATGTATGTTGGCTCATATGCAGCAATGC
TGATGTGGTATCTCGGAAACTATTCGGTACAACCTAACGATACATCCAATACGAATGATT
GTGTGACTTTCTTATGTTATGGTGTCTCGAAGAATGAATTTAGCCATTGGCTCATATGCA
GCAATGCTGATGTGGTATCTTGAAAACTACTTGATACAACCTAACGATACATCCAATATC
AATGATTGTGTGACTTTCTTATGTTATGGTGTCTCGAAGAATGAATTTAGCCGTTGGCTC
ATATGCAGCAATGCTGATATGGTATCTTGAAAACTACTCGATACATCCAATACCAATGAT
TGTGTGGCTTTCTTATGTTATGGATAATATGCAGCAATGCTGATGTGGTATCTTGAAAAC
TACTCGATACAACCTAACGATACATCCAATACCAATGATTGTG