Microarray Probes on PGSC0003DMT400029426

Probe IDChipProbe Sequence
CUST_8548_PI426222305 JHI_St_60k_v1 GGGACTGTCGGGATATTCTGGGTAATATAATGAAAAAGTGGCATATTTCCAAGATTTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400029426

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400029426 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G49120.1 +1 2e-23 95 51/115 (44%) Protein of unknown function (DUF581) | chr5:19908800-19909332 REVERSE LENGTH=150

Transcript Sequence (1032 bp)

>PGSC0003DMT400029426 1032 pgsc_dm_v3.4
AAGATTTTTAAAAAAATGGAAAATAGGAGGTTAGAGTTAAAAGATAAAGAGTCCAAAATA
GGTTAAACGTGGCATTCAACTAAGCATTCCAAGTTTAGATCATTCGCTATGCTACTCGTC
CTTTCTTACTGCCCATTTTTCCCTGCTGTATAGTATTAGGGGTACCCCCTTTTACCCCCC
CTTACTAACTTCTTCTTCTTCTTCTTCGCAGCTCCTATTTAGCAACAAATCTTTCAAGGG
TTTTTCAGATAAACAAAAATCTCTTTCCCTCATGAGATGGTGGGACTCAGTGTAGTACTC
GAAGGTTACAATAATAAAGATATTAATACAACTACTTCTACTTGGCAAATTCTTAACAAA
GCTAGTATGGTATTGATGAAACCCACTTCTCCCTCCTCGATCCCTTTTTCCCCGCGAAAA
TCTCCGGCAGCTTCTGGATTTCTCGATTCCTGTTTCCTTTGTAAGCAGAAACTCTTACCT
GGCAAAGACATCTACATGTACAAGGGAGAATGGGCATTTTGTAGCGTAGAGTGCAGATGC
AAGCAGATTTTTATGGATGAAGAAGACAGTATAAAGACGAAATCTCAAGCTTCGAATTCT
TCTTCTTCTAATAAATCGTGTACTTCCTCTTCTTCATCATCATCGTCGTCTTCTTCCCGG
AGTAGAAAAACGGCGGCGAGGAACCGACCCAATGGGTTTGCATACTGAGAAAGGAGTTCA
GTTCCACGAAAAATTTGCTGCTTTCCAGTTTTGTCCTCGATACATTTTGTAATGACTATG
CTAGCCCTTTCAATTTTATTTTATTACCGTAGTAGTTTTATTTTATGAAATTAATATTAG
TAGTACGAAAATTTGGAAACAAACAAAACTGCTGCTAGTTTTCATTTATCAGCCCCTGGG
TTTTGGTTTCCCGTTGCCAATTTAACTAAATTGCAAAATAATGTTATTGAGAATCTTTCT
TTTTCTAGAATGGGGTTTTGTAGGGACTGTCGGGATATTCTGGGTAATATAATGAAAAAG
TGGCATATTTCC