Microarray Probes on PGSC0003DMT400029165

Probe IDChipProbe Sequence
CUST_10417_PI426222305 JHI_St_60k_v1 TCCAAGAAATTTTCTTATTCAAGCTGTTGTTGGAGTTTTTGCTTTGGGGTTCATTGATGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400029165

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400029165 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G30845.1 +2 6e-28 105 50/81 (62%) unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; Has 16 Blast hits to 16 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 16; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr4:15019895-15020319 FORWARD LENGTH=114

Transcript Sequence (830 bp)

>PGSC0003DMT400029165 830 pgsc_dm_v3.4
GAAAATGTTGATCACACAAAATTTTATCAATTGCTATTCTTCATCTACCAATTTTTCTTA
TATTTTTTGGAAATATAGAAAAAGAAGATTGAGTACTAAACATTCAACAATTTCATTTGC
AAAAAAGAGAGAATTTTCTGAGAAATCAAAAGTTGAAGAAAACACAATTTCATCATTGAA
AATTCCAAGAAATTTTCTTATTCAAGCTGTTGTTGGAGTTTTTGCTTTGGGGTTCATTGA
TGCAGGGTATAGTGGAGATTGGTCAAGAATTGGAGTGATCTCAAAGGATAATGAAGATTT
ACTGAAAATTGCAGCATTTTTAATAGTACCATTGTGTCTCTTTGTGTTATTTTCTTTCTC
TAAGAAAATTGAAGAATGAAAGCGTTTTATATTTTTATCCTTTTTTTAGAAAAGCACAAA
TTATTTTATTTTCAATCAAGTTATTACCATATCTTCTAAGTTGATATATTATTACTATCG
GTCATTACCATCAACTACTTCACGACTTGTTTTCTTAGCAAAACATGATTGAGTGAAAGA
CCAAATATAGTTCAATACTCTATCTACAGAGCCTCTAAGAAATAAGGAGGAGGGAATATG
TGGAACAAGATAAATTTTGTGTTTTCTTTCGGCTTACACGTCAATTTGGAGTTCTCGGGT
GTGTGCCATCATGACACTCGATTTTTGGATCATGACACAAACGTCATCTATAATCTCAAT
CCATCACAATATTTACATGTAGCCTAAAGAATTTACCTTTTATTTTACCATTCAAGCTTT
GTCATATCAAGTCGGGTCGGATCAGTTCCTTTTTGGTGCTCTTAAATTTT