Microarray Probes on PGSC0003DMT400028963

Probe IDChipProbe Sequence
CUST_10333_PI426222305 JHI_St_60k_v1 CTCTGAAGAGTTCTTCGCTGTCATCTTCAACTTTTTCTGCTTTATCTTCAAATGCAAAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400028963

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400028963 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G30260.1 +1 7e-12 62 28/38 (74%) BEST Arabidopsis thaliana protein match is: Galactosyltransferase family protein (TAIR:AT4G21060.1); Has 30 Blast hits to 30 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 30; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:10651159-10651452 FORWARD LENGTH=97

Transcript Sequence (912 bp)

>PGSC0003DMT400028963 912 pgsc_dm_v3.4
TTCTTAAACACTACTTCTACAGTTCTACCAAGGATCTAGGACCTTTTTTCTCAACTGCAG
TCTCTACCAAAACCTACTAAGAAGATGGCAAATGCTCGTATTGCTAGGTTTGTTACAGAG
GTAGCACCACCACAGTTTGTAAATGTCATGAGACACCGAGCCTCAAAAATGCTAGAAACC
ATCAAAGAGGAGGAGAGAGAAGCTAGCACAAGCGAGGCACTCTCTCTGAAGAGTTCTTCG
CTGTCATCTTCAACTTTTTCTGCTTTATCTTCAAATGCAAAAAATTCTAAATATTTTCTC
GAAGAAGTTCAGAGGTCTCTTTCTGCATTTGGCAGCTAAAGTATCTACTTAGGCTTGCTG
AGAGTACTTTCAATTTTCAATTTCCTGACCAATCTACTGATTTCTTGCTGTTTTCCTTCA
GCAAATTTTCTCTTAGTTACAAAGTCAGCGAAGATTGGACTGTAAACTCTTATTGCCAGA
TATATTGACTAAATGTAACCATGTGAGAAAGGAAAATATCTCTATCGAACTATCAGAATA
CTTATCGCTACTTCTTTAAATTTTCCCAAAGTTACTTCAGTCCAGTTAAGAAATTGCTAT
GCACAGCATTTTTGTTTCTTTTTTACGGCAGTGTCCAAGCCAACTTCTGCGCACCTTGAT
TATACCACTGGGTGCCTGCTGCTCCCACCAACCTACGGGGCACCCCTGCCCACCAAGACT
TAGGTAGATGGGAAGAAATCACCTAGTATCTTTTGTCTCGGTTGGGAGTTGACCTTGAGA
CTTCATGGTTCTCCTCCCACTTCATTTACCACTAGGTCACACCCTTGGGTGCCAGTATTT
TTGTTTCTTTTATAAATAAACAAAGTATTCTATTCCACAGCATGCATTTAGACCAGAACA
CGAGAATGTAGA