Microarray Probes on PGSC0003DMT400028480

Probe IDChipProbe Sequence
CUST_51712_PI426222305 JHI_St_60k_v1 CAGAACTCAGTGTCTCACAATGAAATGCATTATGACAGAAAGGGAAGTTTGTAACTTTTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400028480

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400028480 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G79670.1 +1 3e-70 237 125/263 (48%) Wall-associated kinase family protein | chr1:29976887-29979337 REVERSE LENGTH=751

Transcript Sequence (1198 bp)

>PGSC0003DMT400028480 1198 pgsc_dm_v3.4
TTACAAAATAACACACTAGACTTACACACACACGCAGTCGCACACACAGAGCTACTACAT
CAACTCGTGCTCCTATTCACTTCAACCATAATAAACGAACAGTTTAGGATAACTCATTAG
CCACTCATGAACCAAAGATAACTCAAAATACAATTGAACTTAGTACTTCATCACACTTTT
AACATTTAAGTTTACTGTTTACAACAGGTACTTGGTTGTTGCTTAGAAACTCAAGTCCCA
TTATTAGTTTATGAGTACATCTCGAATGGAACCTTGTCATCCCATATTCATGGAAACCTC
AGTCACAGTTCTAACCCTACTGTCTCAAAGTCTGAGTTGGATGATCAGATTCTTCCGCAC
CCAGTAATAATATTATCGTGGGATCATCGGGTGCGAATTGCTGCAGAAATAGCAGGGGCA
CTATCTTACATGCACTCATGTGCTTCTACTCCCATTCTTCACAGAGATATAAAATCAAAC
AACATATTACTAGACGATAATTTTAGAGCAGTGGTTTCTGATTTTGGACTATCGAGATTA
TTGTCTGTTGACAAGACTCATTTAACAACAATGGTAGGGGGTACATTTGGTTACATAGAT
CCAGAATACTTCCGCTCAGGTCAACTTACAGACAAATGTGATGTCTATGCCTTCGGTGTA
ATTCTTGCAGAGCTTCTAACAAGTCAAAGAGTTGTCACTTCAAACCAACCAGAAGATCCA
GGTTTGGTTATCCGTTTCACATTAGCATTGAAAGAAAACTGTATAATTGAGATTGTAGAC
CCTGAAATTGTAAAAGAAGTTGAGGATGAACATGTGATTCCTGCTGTGGCCAAACTTGCC
AAGAGATGCTTAAATTTTAATGCAAGGAGAAGGCCATCCATGAAGGAGGTGGCAGCCGAA
CTTGAACAACAAGGAAAAATGAGGCAAGATATGCCTCATAATGAGAGTTTTCAAGATAAC
ATTTCACCAAAAAGTGAAAGTTCATGTAGTCATACTTCTGATTGTACCGAAGAAGATCAT
CAGAACTCAGTGTCTCACAATGAAATGCATTATGACAGAAAGGGAAGTTTGTAACTTTTA
TAACTTCAACTTTTATCTTTTGTAATTGTAATGTCGAAGTAATTGCATGTATGGACACAT
AATCAAATGAAGATTAGCATGATTTGCATTAATATTTAAGTCGTATATATGATTTGTT