Microarray Probes on PGSC0003DMT400027833

Probe IDChipProbe Sequence
CUST_50798_PI426222305 JHI_St_60k_v1 GGAAGAAAGCATGGGGAATTTAGAAAAGATTGCACTATGCATCATATGTGATTTTTGTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027833

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027833 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G34060.1 +2 1e-37 140 65/103 (63%) Peroxidase superfamily protein | chr2:14384914-14386530 FORWARD LENGTH=346

Transcript Sequence (1110 bp)

>PGSC0003DMT400027833 1110 pgsc_dm_v3.4
ACTACCCTTTTGATGCTTCTTTCCCTTGCGGTTCTTCTTTCCTCCCTCTAAACGGACGTT
GGTGGTGCTAGCGGTGTTCATGTCTCCTTCAGTTGCCATTCCCTTAGTGCAAACCTTCGC
TTTGATACCACGTTATCACGGACTTAGAGTCTTACTAATGCTCCGTGCGGCACTTGACAA
CTTACTCACGAATCTTTCACGATCTTGTAAGCTCAAGTAAGCCTTTACGACTAAGATCGC
TAAGAGAATGAAAAAGGAAGACTTAGAGAATTTTGGAAGAAGGCTTTTTATATTAAGCTT
TGGAGAATGCTTTACAAGTTTGCTTACAACTTGGTTGGATGGATGGTTGGATGGATGGAT
GCCTTGCAAATGAATGGCACCACCTATTTATCCTAAATCCTAAGGACTAAAGTGCAAATA
AAAATTACTTACAAGTCCCTAAGATATTTACACAAAAGCCCCTCTTCTAGAATTCTCTAC
ACACTCTAGAGAATTCTAAGGCTTTCTTTGGAAACTATCTAAATTATTCTAGAGAATTCT
AAGGAATTCTCTAGCCTTCTTGAATAATCTAGAGGGTTCTACAGTCTTCCGGAAACCTCT
CCACAACTCTAGTCCCTTCCGCCCCTATCCGGACGCAAAATTTCACTGTGATGTGGCGGG
ACGTGACACTAGGCTTTTCAAGGCCCTAAAAATGTCATGTCCACAATTTGGTGGAAATGT
TGATATTGTAGCACCATTTGATGTGACAACACCCTTCTCATTTGACAATGCTTATTATGG
GAACTTAGAGGCTAAATTGGGATTATTGGCTTCTGATCAAGCTTTATCTTTGGACCCAAG
GACTAAGCCATTGGTTCAAGAATTGGCTAAGGATAAACATAAGTTTTTTCAAGCTTTTGC
TGATGCTATGGAGAAAATGGGAAGTATTGGGGTCAAAAGGGGAAGAAAGCATGGGGAATT
TAGAAAAGATTGCACTATGCATCATATGTGATTTTTGTGTTATTGGATATTTGATTTTTC
ACCTAATTATTTATTTTTATTATTATTTGATTATTTCTTCTAATTTTGTTGAAGGAATCT
TGTACTGCTTGAACACATCTATGATATCTC