Microarray Probes on PGSC0003DMT400027692

Probe IDChipProbe Sequence
CUST_23992_PI426222305 JHI_St_60k_v1 GAGATTATGGTGTTAGATGAATTTTTAGACTGTTTTGGACTTGGACATCGATTAGATGTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027692

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027692 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G23970.1 +1 1e-89 273 127/247 (51%) Class I glutamine amidotransferase-like superfamily protein | chr2:10199698-10201081 FORWARD LENGTH=251

Transcript Sequence (1042 bp)

>PGSC0003DMT400027692 1042 pgsc_dm_v3.4
AGCAAAACAAAATTGAGAAAAATCTCCATCTCTCTCTAGACCTTCCTCTAGAGAGAGAAT
TTATTTAGTGAGTGAGAGGATTTAAGAAGATTTCTTCTTCTTTATTTCTGCAAAATCTGT
AATTAATTAATAATGGAAGGAAAAAAATTTGCAGTTCTATTATGTGCAGAGGATTCAGAA
TACGTGAAGAAGAAATACGGTGGTTATTTCGGGGTTTTCGTGAGAATGCTGGCGGAGGAA
GGGGAAACGTGGGACTTTTTCCGGGTGGCTCATGGCGAGTTTCCGACGGATGATGAGATC
GGAGAATTCGATGGATTTGTAATCACCGGAAGTTGCAATGACGCGCATGGCAATGATTTG
TGGATCTGTAAGTTACTCAATCTGCTCAAAAAAATTGATTCAATGAAGAAGAAAGTTTTG
GGTATTTGCTTTGGACACCAGATATTAGGACGATCATTGGGTGGCACTATAGAGAGAGCT
ACTAATGGATGGGACATTGGTGTCACTACTGTTAATTTATCAACGTCCAAGCAATTCAAC
TCTCTCAAATTACCTGCATTTTTGCAAGTTATCGAGTGTCATCGCGATGAGATCCGTGAA
CTTCCACCAAAGGCAGAGGTAATGGCCTGGTCCAACAAAACTGGAATTGAGATGTTTAGA
TATGGTGATCACATCATGGGTATTCAAGGTCACCCTGAGTACACCAAAGACATTCTTCTC
CATCTCATTGATCGTCTTCTTCAACACAACCTTATTGAGGAGAGCATGGCTGATGTGGCC
AAGGCAAAGGTTGAAGAGCGTGAGCCAGACAGGGAACAATGGAAGAAATTATGCATTAGC
TTTCTCAAGGGTAAATTGTGATGGCAATTTATTAGAGGCTATTGGAATTGGTCAAAAAGT
GTAAATAGGAGATTATGGTGTTAGATGAATTTTTAGACTGTTTTGGACTTGGACATCGAT
TAGATGTCATTATCAAGAATTTACTATTAAACTTTAACTAATGAAATTGATAATTAAGTT
CAATTGCAATTGAATTATTTTG