Microarray Probes on PGSC0003DMT400027659

Probe IDChipProbe Sequence
CUST_8549_PI426222305 JHI_St_60k_v1 GAAACCGTAATATCGCTATAGTAATGAATAGGTAGTAGCTGAAAGTTGCAATCATTCAGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027659

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027659 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G18670.1 +3 0.0 579 297/524 (57%) beta-amylase 3 | chr5:6226138-6227999 FORWARD LENGTH=536

Transcript Sequence (1944 bp)

>PGSC0003DMT400027659 1944 pgsc_dm_v3.4
CTTTGTTCAAATTTTTAGCTCTAAATCCTTCATTTTACCAAATTAGTTGAAATTCCCCTC
TGCTGATTGTCAAGAATTTGTTTGTCTGACAAAAGGCCCAATTTTTCTGGTTATATCATT
AATTTCAGATTCAAAGGAAAATTATGGAGGTTTCAGTGATGGGAAGTTCTCAGGTGAATT
TGGGTAGGAATGATTTGGTATGTAGAGAAGTTGGAAATTGTAGTTTTACAAAGAGTTTCA
ATTCAAACATCTCCTCTTCTTCTTCTTCTTCTTCTTTGAAAAGTTCAAAATTATGTATAA
AATTGCGTTCCAAGTCTTTGAATAGGTTTAGTTTGAAAGCATCTGCTTGTTCACAACCTG
AACCACTCATATCGAAGAATAACAGAAAAACTAAGACGACTGATGGTGTGAAACTATTTG
TTGGGTTACCACTTGATACTGTTTCAAGTACTAATACAATAAACCATGCTAGAGCAATTG
CAGTTGGATTAAAAGCATTGAAGTTACTAGGTGTTGATGGCATAGAACTACCAGTCTGGT
GGGGAGTTGTTGAGAAGGAAACCAGGGGAAAGTATGACTGGACAGGCTACCTTGCACTTA
CTGAAATAATCCAAAAGTTGGGACTTAAGCTTCATGTGTCACTTTGCTTCCATGCATCAG
GGGAAGCCAAAATTCAACTCCCAGAATGGGTTTCTCAGATTGGTGAATCTGATCCTAGTA
TCTTCTTCAAGGACCAATCAGGACAACACTATAAAGATTCTCTTTCGTTTGCTGTTACTG
ATGTTCCTGTCCTTGATGGAAAGACTCCGGTTCAAGTCTACAAAGAGTTCTGTGAGAGCT
TCAAGACTGCATTTTCACCGTTCATGGGCTCCACAATCACGGGCGTTTCTGTTGGTCTAG
GACCAGAAGGCGAGCTTCGCTATCCTTCTCATCACAATCCATCCAAAATGAACAATTATC
AAGGAGCTGGTGAGTTCCAGTGTTATGATAAATACATGCTGAGTTCTCTCAAACAGTATG
CCGAAAGCAACGGGAATCCTCTGTGGGGATTGGGTGGTCCGCACGATGCCCCTGGTTATG
ATCAACCACCCATGACAAGCACCTTCTTCAAGGAGAATGAAGGATCTTGGGAGACGACTT
ATGGTAACTTTTTCCTTTCTTGGTACTCGGAGCAGCTCATTTCACATGGAAGCCGACTTC
TTTCGCTTGCCTCTGAAACATTCCATGATGTTCCAATCTCCATTTGTGGCAAAGTTCCCC
TTGTGCATTCTTGGTATAAAACCCGATCCCATCCTAGCGAGCTAACAGCCGGTTTCTATA
ACACAGCCAACAGAGATGGTTATGTAGAAGTCGTTGAGATGTTTGCAAAGCATTCGTGCC
AAATTATCTTGCCTGGGATGGATCTCTCGGACAATCTCCAGCCAAACAAATCTCTCTCAA
GCCCAGAGTTGTTGGTTGCTCAAATTACATCATCTTGTAGAAAGCAGGGAGTGGAAATCT
TGGGGCAAAACTCAATGGTTGCAAATACACCAAATGGTTTCGAACAGATAAAGAAGAAGT
TGTCAAGTGAAAAGGAAATGAGCTTGTTCACATATCAAAGAATGGGTGCGGACTTCTTTT
CTCCTGAACATTTCCCTGCATTCACTCAATTCGTTCGGAACCTTAATCAACCAGAACTGG
ATTCGGATGATCAACCAACAAAACAAGAAGAACGTGTTGCCAGTAATCATCTCCAGATGC
AAGCAGCTTAGATTCAGATTCTATGTACATATTGGTAATCATCTTAGAAACCGTAATATC
GCTATAGTAATGAATAGGTAGTAGCTGAAAGTTGCAATCATTCAGTTTTTCTGTTATATA
TATATATGTATTGTTATAGTATGAGAAAGTTTGTTGGCTTGAATTATGAAGATAGCTTTC
AAATATATTTCTTCTTTGGTTGCA