Microarray Probes on PGSC0003DMT400027239

Probe IDChipProbe Sequence
CUST_47563_PI426222305 JHI_St_60k_v1 CACCAACGTCTGCTCCATTTCGACATTAGAATGATTTCTAGTAATAAATTTGAAAGACGA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400027239

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400027239 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G66980.1 +3 3e-73 162 78/181 (43%) suppressor of npr1-1 constitutive 4 | chr1:24997491-25001961 REVERSE LENGTH=1118

Transcript Sequence (1920 bp)

>PGSC0003DMT400027239 1920 pgsc_dm_v3.4
TTCTTTTGGGAATTATTATGATGGCATTCTATGAGTGTTATAGCTCAAGCAAAATTGAAA
GAGAGAATCAAGCCAGAGTTGAAAAGTTTTTGGAAGACTATAGAGATCGCAGACCGACTA
GATATACTTATGCAGATATTAAAAAGATAACAAATCAGTTTCAGGAAATATTGGGAGAGG
GAGCTTACGGGATCGTTTATAAAGGAACACTTTCGAATGAAATTCACGTTGCTGTAAAAA
TTCTCAATGATTCTGAAGGAAATGGGGAAGAATTTATTAATGAAGTTGCAGCAATGGGGA
AAATCCATCATGTCAACGTGGTTCGCCTAGTTGGCTTCTGTGCTGATGGAGTTAGAAGAG
CTCTAGTGTTTGAATACTTGCCAAATCAGTCACTTGACAAGCTCATTTTTCCGACAAGTT
TCAAAGATAATATCACCCTTACTTGGAAGAAGCTTCATGATATTGCTATGGGAATAGCAA
AAGGGCTAGAGTATCTTCATCAAGGATGTGACCAACAAATCCTTCATTTCGATATCAAGC
CTCAAAAATATTCTGTTAGACCATAACTTGAACCCAAAGATCTCTGATTTTGGTCTTGCC
AAGTTATGCTCTAAAGAGAAAAGTGTTATCTCTATGACTGAAGCTAGAGGAACCATGGGT
TATATTGCACCAGAAGTGTTGTCAAGCAATTTCGGAACAGCGTCTCATAAATCTGATGTT
TAAAGCTTTGGAATGCTGCTTCTTGAAATGGTTGGAGGGAGGAAGAATTTTGATGCAAAG
GCGGATACTAGCCAAATGAACTTTCCCGAGTGGATTCATGAGCGGCTGAATCAAGGAGAA
GAGTTGAAAATCAGGATTGAGGAAGATGATGATGTTATAATTGTAAGGAAATTGGCTGTT
ATAGGAGTTTGGTGCATCCAATGGAATGCGATAGATCGGCCATCCATCAAAGTTGTAACT
CAAATGCTAGAAGGAGATGAAAGGTCAAATCCATATGCCAAAGAGTTATGCAAACTCAAA
ATAGAAATATTAGCATTTGCATCCTGAATATGCCATGAAGTCATTGACATGAGGTCTACA
CTACACCCGACTTTCAAATCGGATGGTGATAATTCAGTCATGGTTGCATATGTGTGTCCC
TTAAATGAATCAGAAGAAACATTGGAAGCATAACTCCTGTTGAGACAATTAGTGATTTCC
ACAAAGACTGGAGAATTTAAGGCAAATGGACAGCTGAAGAGAGTGATTGGTACTGTTAAC
TTAACAAAACCAGGCATTGATTTTATAGAAGAATCAAAACCAGAAAGGGAAGTGTAAACC
GAAATCGAATTCTGAGGAAGAGAGCAAATAACTTGTTCTCTTATACCAGGATCTACAAGG
CGGATAGTGGAGTTATCGTAATTGATGGCTTGAACATAGTAGTTCAGTGATTCATTCCAA
TCACGTGGCAGTATTGTGATTATGGCGCGATCTCCTTCACAGCTCAATTCATAATTTTTA
AGGCCACAGTGCTTTGGATCACTTTTCAATCGAAAGGGAAAATTGATGTTATGAATATCC
CCACAACTAAAAGGGACACACTGATTTCTTTGTTCTGCTAATGGGGTTTCTCTTTAAAGT
TCCTAGTCATCTTTCTTATGTTGGAGTTGGAATATCTAATGGGCGCGAAATTGTTCTCAC
CGTGCAGGAAACTTTCAATTGCATCATAAATCGACAAATGCCTTCTTCGTAACTTAATCA
TTAGAAATACAACTATGCATGGAAATAGAACGATTCTTGGCACAATGCTAAGCCCTGTGT
ACAACCATCACAAATAAGCAAGAAAAGTTTGTGAATGGTTAAATTAAAAAATTCAACCAC
CAACGTCTGCTCCATTTCGACATTAGAATGATTTCTAGTAATAAATTTGAAAGACGAAAG