Microarray Probes on PGSC0003DMT400026970

Probe IDChipProbe Sequence
CUST_16100_PI426222305 JHI_St_60k_v1 GGTGGACACTCTAGGATCTTTTGAGGAAATTTTTATGGAAGAAGATTCTTGCATTGATTT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026970

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026970 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G67020.1 +1 7e-43 157 85/225 (38%) unknown protein; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G50340.1); Has 1807 Blast hits to 1807 proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink). | chr5:26749962-26751146 FORWARD LENGTH=394

Transcript Sequence (1286 bp)

>PGSC0003DMT400026970 1286 pgsc_dm_v3.4
TTTATTTTTAGGATTAGTGAAATCATCTCCATCCCACCAAATTCTCCCTTATTTACTCTA
ACTTCTTCCTACTATAATCTCTCACTTTCTTTCATTAGAAATCAAATCCTTTATAAATTC
ATATATCCAAAGAACACTTTCTATTAGTTCATGCTCTGTTTTGGCTCATTAGCCATGGCA
GCAACACTTGCAGAAACATTGAGCCCCATCAAAATCTACAATCCAAAACCAACAAAAGTT
TGCTTTTCATATGCAGCCTACGCTAAAAATGTCATACAACACCTCAAATCATCCAATCTA
ATCGTTGAAAAAGGACTTTCCGACGTTGAATTCTCCACCATTGAATCTAATTTCAGTTTT
ACTTTCCCACCTGATCTCCGTTCTATTCTTCAAGAAGGTCTACCCATTGGCCCTGGATTT
CCCAATTGGCGATGCTCATCTCAACAGCAATTAGAGATCATCAAGAATTTGCCCATTTTG
AGTTTGTGTAAACAAGTGAAGAAACGCAATTTTTGGGTTGAATTTTGGGGGAATAGGCCA
ATTGATAATGATCAAGCTGTGGATACGGCAAATGGGTTCTTAAAAAATGCCCCTGTTCTC
GTTCCGATTTATCAGCATTTTTATATTCCGTGTACGCCCTGTTTGGCTGGGAATCCTGTG
TTTTACGTTCACGATGGACAGGTCAAATTATGGTGTTTTGATATCTCTGGGTTTTTTCAA
CAAGTAGAATTTCAGAGAAACGAGATGATTCTGAGAAGACCCAGTTTGTTTAACTTGATG
AATGCACCGTCATGGGCGGCGACGGAAGCGAGGAAGATTGACTTCTGGACGGAAATGGCG
GAGATGGGTCAAATGGCAGCGGCGGTTGGCGGTGGAAAGCACCGGCGGTGGTGGAGTGAG
GATCTAGAAGGGTATTTAGAGGATGTGTTTTTGAGGTTGACGGAAGCAGGGTGGAAAGAA
GAGGATGTTAGAGAGATGATGATGATGGATGATTCCGGCGACGGTGATTCCGGTGACCGG
AGGAGATGCAGCGATGCCGTCGTATTTGTCAACAAGAAGGAGGTGGAATCGCACGAGAGT
TTGTTATTACGTGCGGGGTGGAGTACGGAAGATGTGGTGGACACTCTAGGATCTTTTGAG
GAAATTTTTATGGAAGAAGATTCTTGCATTGATTTTTATCACAAAACAAGTTAAATGAAT
TTGCGTTAATCAAATATTAGTATAGGAATTGTAGTATACTTTTCATTTTTACTACCGTAT
ACAATTTAGTTGAATTAATATCAAAT