Microarray Probes on PGSC0003DMT400026852

Probe IDChipProbe Sequence
CUST_42594_PI426222305 JHI_St_60k_v1 GGATTGCCTTCAGCAAGAAATCTAAATGTGGAACTTGATGATGATTTCCTTAATGTATCA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026852

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026852 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G02300.1 +1 8e-163 471 230/409 (56%) Cysteine proteinases superfamily protein | chr1:453288-455376 FORWARD LENGTH=379

Transcript Sequence (1538 bp)

>PGSC0003DMT400026852 1538 pgsc_dm_v3.4
GGAAACGCTCCCCCTAGGCCCTACACGGTGCGAATTTGAAATAATCGGCTCTAATATTAG
TAACAGAGAATATCATCTCTACTGCTAGCTTGGTATATAGTCCAATAATTATTGTACGTC
AAAGAGTGGGCCACTACTTGTCTTTCGTTCCATGTTTTTCTTATTATCTTGTATCTACTA
CTACATATTTCTTTGAGTTTCCAACCACTATTGGAACTCAAAAAAAAGAAGGTGAAAATG
GGCATGACCAAGATTTCCTTAGCAACTCCATTGCTTTTATGTGCTTTCTTTATCTTTATC
CTGCAGGTTTTTGCAGAGAAGCCAATATCTGAAGCTAAAGGTGAATCCGTAATCCTTCAG
GAATCAATCATAAAAGAGGTGAATGAAAATGTTAAAGCTGGATGGAAAGCTGCATTCAAC
CCTCGGTTCTCGAATTTCACAGTTTCTCAATTTAAGTTCCTGCTCGGAGTTAAGCCCCCA
AGAGAGGGTGATCTTAAGAGCATCCCTATTTTAACTCATCCAAAACTTAAAAATTTACCA
AAAGAGTTCGATGCACGAACAGCTTGGCCTCAATGTAGCACAATTGGAAGAATTCTTGGT
CAGTTTCTTCATCTTATTGTTTGGTCCTTCTATGCTATATTCTGATTAGTACAATGCTGA
TGTTTTCTGTACCTTACATTGCAGATCAGGTGACTGCTCTTGCTTACTATTTAGTCTCAC
TCTTGAAAATGCTAAATGCCCTTTCCAGATTCTATAGTGGTCTTATCCTTTATATTCCAG
GGACATTGCGGTTCTTGTTGGGCTTTTGGTGCTGTTGAATCGCTTTCTGACCGTTTCTGT
ATTCATTATGGCTTGAATATATCTCTATCCGTAAATGATGTAATAGCATGCTGTGGCTTT
TATTGTGGGAATGGCTGTGATGGTGGATCTCCCATAAGAGCATGGCATTACTTTATCCAC
AAGGGTGTGGTTTCAGAAAAGTGTGACCCTTACTTCGATAATATTGGATGTTCCCACCCT
GGTTGTGAACCTATATATCCCACCCCACAGTGCAACAGGAAGTGTGTTAAGGAGAATCTA
CTCTGGAGTAAGTCCAAGCATTTCGGTGTGAATGCATACATGATCAGCTCCGATCCATAC
AGTATCATGACAGAAGTTTACAAAAATGGACCAGTTGAGGTTGCTTTAAATGTTTATGAG
GATTTTGCTCACTACAAGTCAGGAGTTTACAAGCACGTAACAGGGGAGTATATCGGAGGC
CATGCTGTTAAGCTCATCGGATGGGGAACTAGTGAGGAAGGAGAGGACTATTGGCTTCTT
GTGAATTCTTGGAACAAAAGCTGGGGTGATGATGGGTACTTCAAGATCAGAAGAGGAACA
AATGAGTGTGACATTGAATCTAATACAGTTGCAGGATTGCCTTCAGCAAGAAATCTAAAT
GTGGAACTTGATGATGATTTCCTTAATGTATCAATGTAAAATGCTACTTCATCAACAGGA
CACCTAAATAATACTACTACCAAATCTATGCAATTTAT