Microarray Probes on PGSC0003DMT400026560

Probe IDChipProbe Sequence
CUST_7017_PI426222305 JHI_St_60k_v1 ACAAAAGCTCTTGGTGAAATTAGGCCTTTTGGAGTAGAGGGGTACTTGCTGAAGAGGCTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026560

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026560 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G24200.1 +1 9e-66 215 106/145 (73%) Cytosol aminopeptidase family protein | chr2:10287017-10289450 REVERSE LENGTH=520

Transcript Sequence (747 bp)

>PGSC0003DMT400026560 747 pgsc_dm_v3.4
ATGTCGCCGAATGACTTCGGCGACTCCCCCTTCGTCTATCTCATCGCCGTTTCATGCTTG
CCTTCAGCACCTTCACGTTCTGGACCATTGGGCGGGGTACTTGCTGAAGAGGCTAAAAAG
ATTGTGTCCACTTTTAGCGATGTCATTTCTGTAAACATTTTAGATGCTGAGCAGTGCAAA
GAATTGAAAATGGGAGCCTATTTATCTGTTGCTGCAGCAACTACTGAAAATCCTCCTTAC
TTCATCCATTTATGTTTTAAAACTCTTACTAACGAACACAAAAGGAAGATAGCCTTGGTT
GGGAAGGGATTAACTTTTGACAGTGGTGGCTACAACCTCAAGACTGGAGCTGGTTCGAAG
ATTGAGCTAATGAAGTATGACATGGGAGGGGCTGCCGTTGTTTTAGGTGCAACAAAAGCT
CTTGGTGAAATTAGGCCTTTTGGAGTAGAGGTGCATTTCATTGTTGCAGCTTGTGAAAAT
ATGATCAGTGGAGCAGGCATGAGGCCTGGAGACATTGTCACAGCTTCAAATGAAATTCAT
TTTATAAATCTACTAATAATGGAGCTGGCATCTTCTTCTTCTTCTTTTTTTTTAATCTTA
TTTCAATATAGTAACGAACTATTTAATTTTATATTTGAAAAAAAAAGAATAGGAGTAAAT
AATGTTTTAGCAAAGAACCTTGTTGTAAAGGAAGTGTACAAAGAAATAAAGTGTGAAGGG
TATTTTTGTAAACATACATTTTTTTAA