Microarray Probes on PGSC0003DMT400026549

Probe IDChipProbe Sequence
CUST_41881_PI426222305 JHI_St_60k_v1 CTGATCGCTTCAATCCAAATGTAAACCAATTTTATGATTCTGAGTTGTTTGGTGTGAGAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026549

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026549 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G28600.1 +1 6e-128 379 187/350 (53%) GDSL-like Lipase/Acylhydrolase superfamily protein | chr1:10051228-10053073 REVERSE LENGTH=393

Transcript Sequence (1315 bp)

>PGSC0003DMT400026549 1315 pgsc_dm_v3.4
TTTGTCTTTGTCATGACTTCTTCTTCTCTAAAATTGGTTAAATGGAGTTTCTTGTTTTTG
GTCTTAAACCATAATTTTCAAAATATTGAGGGGTGTTTCGACTCCATTATTAGTTTCGGC
GATTCGCTTGCTGACACTGGAAATAAACTTCATATCACTCTAAACAAAATCCCTCCTTCC
CATTTCTCCTTGCCACCTTATGGTGAAACCTTCTTTCATCATCCTACCGGTCGCTTTTCT
GATGGACGTCTTGTTATAGATTTTATTGCTGAGAGTTTTGGGCTCCCATTAGTGCCAGCA
TATTTGGAAGGAAAAGATGAAAGGAATTATATTGTAAAATTCAGGCAAGGTGTGAATTTT
GCAGTGGGAGGGGCAACAGCACTTGATTCTGCCTACTTGTTGGACAAGGGAGTAACGTCC
AGTAACAATGTGTCTTTGGGGACTCAACTGGATTGGTTCAAAGATATGATGTCTTCTTTT
TGCAAATTTCCATCAGAATGCAAGGAATTTCTTCAAAACTCATTGATACTTATGGGAGAA
ATTGGAGGCAATGATTTCAACTATGGTTTTCTTGGAAATAGCACCAAGGAAGAGGTTGAA
TCATATGTTCCAGCAGTCATCAAGACTCTTAGTTCAGCTATACAGGAATTAATCGAGTTA
GGCGCAAGCACACTGTTAGTTCCAGGGGATTTGCCGATTGGATGTTCAACAGCTTATCTC
ACAAAATATATGCACTCAGATAAGGGACAGTATGATCCCAAAACTGGTTGTTTAAATTGG
CTTAACAACTTCTCACAGCAATACAATGAGCTTCTTCAGAAGGAACTTCATCTTCTAAGA
GACCTTTATCCTGCTGCTACAATAATCTATGCTGACTACTACAATGCAGCCATGCAATTT
TATGCCTCTCCAAAGAGCCATGGTTTTAGAAAAGGAGCTTTAGTTGCATGTTGTGGGGCG
GGAGGGCCATACAACTTTATGTTTTCTACAATATGTGGGGATCCAGCTGCCAGAAATATT
TGCAGTGACACTTCAGTGTATGCTAGTTGGGATGGAATGCATTTTACAGAAGCTGCATAT
AAATGGATTGCCACTGGACTTTTAAAAGGCACTTTCACTTTTCCTCCCCTCCCTAAAATA
TGCACTGATCGCTTCAATCCAAATGTAAACCAATTTTATGATTCTGAGTTGTTTGGTGTG
AGATATAAGGTATAATAATTTCAAAAATAAAATGCAGGATATTTTATCTTGTGTTTGGTT
GAAGTTATTAGACAGTCTTGAAATTATTTACACTACAACAAAAACAATTATTAGC