Microarray Probes on PGSC0003DMT400026532

Probe IDChipProbe Sequence
CUST_41916_PI426222305 JHI_St_60k_v1 TAAAATTAAATATGCTCATTAGGGGGTTCTGCAATTCTCTGTTTGCTCTCTTTTTGTCTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026532

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026532 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G06330.1 +3 8e-30 110 60/123 (49%) Heavy metal transport/detoxification superfamily protein | chr1:1931671-1932266 REVERSE LENGTH=159

Transcript Sequence (627 bp)

>PGSC0003DMT400026532 627 pgsc_dm_v3.4
TATTAGTATAGTCTATAGACACACAAAGGAATACGAATTAAACTTAGACATTAATTATTT
CATCTAAAGGAAGTTTACATTTGTGTTGCTAGTAGCTCCTCCATCGTCTCAAAGTCACAC
AATATGACGGAGTGGACAACATTGACATAGACATGAACATGCAAAAGGTGACAGTAACAG
GGTGGGCAGATCAGAAAAAAATCCTCAAAACAGTGAGAAAAACTGGAAAGAGAGCTGAAC
TATGGCCATATCCATACAATCCTGAATACCATAACTATATGCATCATTACTATTATGATA
CATTCTACAGCAGGCCGGGCACTTACTATGCCCCGCCTTCTTCCTACAACTACCGCGTGC
ATGGCTACAATGGCCATGCTCACGGTTCCTATGCAGAGCTACCTTACAATACCATTTTCG
ATGAACGAACCAGGCACATGTTTAGCGATGACAATGCAACTGGTTGTTCTATAATGTGAT
TTGAAGTAAAATTAAATATGCTCATTAGGGGGTTCTGCAATTCTCTGTTTGCTCTCTTTT
TGTCTCTACTTTTCCCTATATATATGTTTCATTTGCTACAATGAAATCAGAATCAAGTTG
TACGATAGATGTGTTCTTTTGCTTGCA