Microarray Probes on PGSC0003DMT400026504

Probe IDChipProbe Sequence
CUST_41910_PI426222305 JHI_St_60k_v1 GCCCTTGCCTTGAGATATGAATGAATGACATTTGATTCTATATGACATTCTGGTATAGTA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026504

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026504 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G29240.1 +2 6e-33 135 162/606 (27%) Protein of unknown function (DUF688) | chr1:10217023-10218924 REVERSE LENGTH=577

Transcript Sequence (2671 bp)

>PGSC0003DMT400026504 2671 pgsc_dm_v3.4
AGGCTGACCATTCTTCCATTTTTCTCTCTCCAATTTGTGCCCTTTTTTTTCTCTCCACAA
CTCGCGCCATCATTCAAGGACACATTTCACTCAACTCTCACTCCTTTAACTTTCCCCCCT
TCAACTTCAAGTGATTTGGAAGGCATATACGCCATTGTTGATTGCTAATTTTGTTTCGGA
GGGAAGGGAATAGAAATTTTGTTAGTTGAACAGACAAATGGCGAAAAAGCAGCTGGATTT
CAATGCACCTCTTTTATCTGTGAGGAAAATAGCATCATCTTTAACTCCCAATGAGAGAGC
AAATAAAAAGATGGCAGATAAGGTACCACCAAATCGACAACAATCACTACCTGTCAAAAA
ATCAGATTGGGAATTGACTGAGGTGACAAAACCAGTAGCTGTTCCATTTGTGTGGGAACA
GATCCCTGGAAGACCAAAAGATGACATTGAAGTCCGAACTAGCCTTCGTGTGGAGCGTTC
AAGTAGTCCTAGGTTGCCTCCAGGAAGATTGCCAGAGACTGTTCGGTTCTATTCGGGTGA
AAGGCCTCGTACTCATAACATTTACAGGTCTCCAGCTGAAGGACTTCCTTGGATGGATCA
TGCAGCTTTACTGGATAGCCTGGTGGAAAGTATATACACGAGAGGAGATAGAGAAAGTGA
GGATGGTGCTTATTCTGATGGTCCTGAAACAATGTCACCTACCGAATCCTTATCCTTGAA
CTGCAGTGTCAGTGGTCTGAGCGGACATCAAACTTCAGATTTGCAACCATCCGGAACCTT
TTCCATTGACTCCCAAACTAGAGACTTTATGATGAGTCGATTCTTGCCAGCAGCAAAAGC
TGTTGTGTTGGAGACTCCTCAATACGTTCATAAAAAACCAGTCTCTGCTGAACAACCGAT
GCCAGTCAAAAAGCTGGTCCCCGTGGAACGAAAACCTTTGGTTAAGCCATTGGAGTCTAA
CCCTGTCTCATATTATAGCAGCCATCCAGCTGATGTAGGAAGTGAAACTGAAGATGATGT
GCCTGAGAATCCGGACAAAAAGCCAAGTAAAGGGTGGAGATTTTTCCCTCGGATTTGTGT
GAAGAATTCTTTGTGCCTATTAAATCCACTGCCAGGATTGAAAGTGAAGACACGTGCTCC
GACACCCTCGCCTCAAGCAGTGAAGAGAGTTTCAGGAACGAAACCAAAGATGGCCCAGAG
TCCCACATCTTATGCTCATGAAGTCAAGAAATTAACTAGAAAAGCTTATAGTGGTCCTCT
TGAGAAGAATGCTTGTGATACCATTAATAAGCAAAGATTTCATTCTGGAGTACTGTCCCG
CGAGCTGTACAAAGCTGATAATAGAAGTATGTCCGGGCAGCTGTCTAATCCAAACGACTC
ATGTAAGCTAGTTGGAATCTCTCCTGGTAGGCGTTCAAGAAGTGGGGCTATATCTCCTTA
TCGAAATGTAGCACCCCCATCTCCATTCAATGAGGGTACAAGGTTTCTTGGTGTCCCAAA
GGAAATGGAGAGTCTTTGGGCTAGTCGCTTTGATTCATTCCGCAAAGGTTGCTACACTGT
CAAGGACAAAGCAGTACCACAGAGAATGGGCACAGGAAAGTTTTTTGATTCGCCAAGTGA
AGTAGTTGAGAAAACCTTGTACATAGATTCTGTAGATAATGTGCAAATTTCAGCCCCTAA
CGCTGCTTCTTTGAAACCCAAGGGAATAGTGAACTCCCCGGATAAGATTATGAAAACTCT
GGTTGAAAACAGAAAAGTGGTTGAAAACTTGGCTGCCATGTCTCCTATTCAAGGTGCCAG
GCGCTCAGATGTTTTAGAGAAAAATAGCAAACAGATTGTTGAAAAGGAGTCTTCCCTTGA
TTTGATTGAAGCTTCTACAATTTCCATATCAACACACAAAGGTCCTGCTGATCAAGAGTT
TTTGAAACTAGAGCAAAATGTTGATACAGTATCTGGAGCCTTAGAGTCTTCAAAAGTTCA
TCCTTGTGGGAATTTAGTTACAGAAAATGAAGATAACCAAAATGCAAAAGACTCAAAAGA
TTCTAACCTTACCTCCTTGGAATCTACTTTACCACCACCATTACCTAAATCTCCCTCTGA
GTCTTGGCTTTGGCGCACGCTGCCTTCCATTCCTTTGAGAACTCCATTCTTGAGTTTTAA
CTCTAAGAAGCAGAATCAGAAGTCCCAAACTGATGGTACCAAGTGGGAGACAATCGTGAA
AACTTCTAATTTGCATAAGGATCATGTCCGTTACTCTGAGGAACTATATACTCTTGGTTC
TTGTCAGCAGAGCAAATCTTGAAGATGGATCATTCATAAAGATGAAACATCTTGTTTCTT
TCGGTATAGCTTCAATGCTATCCTGAAACTACATTTCATTCCTCTTGGAATTTCCTTGTC
ACTATTTTAGTCTAGGTGTACGAGGAAATTTTTTTCCTATTCCACCTCAAAAAATTACTT
GGTTTTGATGGTGGCGATTGTTGTAATTTTCAATAGTGGCATAGTAGTGGGCATGAGAAT
TGCTGAGTTTTTTGTGTTCCTGAAAACCAGCCCTTGCCTTGAGATATGAATGAATGACAT
TTGATTCTATATGACATTCTGGTATAGTATTGTTTTTTCATAATGTGTGGCCTTGAAGTA
AATATCTTTAGCTTTTCTGGTAATATTTGAT