Microarray Probes on PGSC0003DMT400026491

Probe IDChipProbe Sequence
CUST_41884_PI426222305 JHI_St_60k_v1 GAGTGTCTTCACCTTCCTTAAGGTGCGTGAGAAGAAAAAATTATATGTTAAAATGACGAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026491

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026491 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G27420.1 +2 3e-111 335 168/324 (52%) Cysteine proteinases superfamily protein | chr2:11726311-11727519 REVERSE LENGTH=348

Transcript Sequence (1303 bp)

>PGSC0003DMT400026491 1303 pgsc_dm_v3.4
ATTTTATTACCATTTACTATCAATGGCTTTCAATTTTTGCCTCAAGAATATTATTATTCT
TGTTCTTTTTTTCATTCTTAGCCTATCTCCCTTTATAGTAACTTCCCGCGACTTAAAAGA
ATTATCCAAATTATCCATGCTTGAAAGACATGAAAAATGGATGGCTCGTCATGAACGTGC
ATACAAAGATGAGATAGAAAAGGAACATCGCTTCAAAACATTTAAGAAAAACGTTAAGTT
CATCGAATCGTTCAACAAGAACGGAACTCAACGTTATAAGTTAGCCGTCAACAAATATGC
TGATCTGACCACTGAGGAATTTACAGCATCATATATGGGACTCGACACTTCATTATTATC
CCAGCAAGAATCAACAGATACAACAACGTCCTTTAAATATGGTAGTGTGACTGAAGTTCC
ATATAGCATGGACTGGAGAAATTCGGGCAGTGTCACAGAAATCAAAGATCAAGGTGTATG
TAGCTGTTGTTGGGCATTTTCAGCGGTGGCAGCTATAGAAGGAGCATATCAAATTGCAAA
CAACGAACAAATTTCACTTTCAGAACAACAGCTGATAGATTGCTCTACACAAAACAATGG
TTGCAAGGGTGGACTAATGACTAACGCCTACAACTTCTTACTTCAAAATAATGTGGAGGG
CATTACCACGGAGAGTAACTATCCTTATGAAGAAACTCAAAGCATTTGCAGCACGGAATT
ACAATCAGCAGCAGTGACAATCAGTGGGTACGAAGTTGTACCAGCCAGTGAATCTGCCTT
ACTACAAGCCGTAGCGAATCAACCGATATCTGTTGGTGTTGCTGCTAACGAGGAGTTTCA
TTTTTACAATGGTGGGATATATGAAGGAAGTTGTAGCCCTAAGCTGAATCATGCAGTGAC
AGTGATAGGTTATGGGACAAGTGAAGAAGATGGTACAAAATATTGGATAGTGAAGAACTC
ATGGGGGAGGGGTTGGGGTGAGGAAGGATATATGAGAATTGCTAGAGATGTTGGGGTTGA
TGGTGGCCATTGTGGCATTGCTAAAATTGCTTCTTTTCCAACTGTTTGAATTGTTATGCT
AAAAGGCATAAATTTTCTCCTAAACTTGTGTCGAAAAGTCAGTTACACGCTCAAACTATT
ATGACGACGTATTACACACCTAATTTTGTTCAAAGTGATATTAATACCCCCTTAGAACGT
GACATGACAAAGAGAGTGTCTTCACCTTCCTTAAGGTGCGTGAGAAGAAAAAATTATATG
TTAAAATGACGAATTTCAACACATGACACTATTTTATTGGTCA