Microarray Probes on PGSC0003DMT400026490

Probe IDChipProbe Sequence
CUST_41930_PI426222305 JHI_St_60k_v1 TGTGTAATCCATCTATGTTGTGCTTTGTCGTCTCCGAATTGAAGTTTGGTTTGTTATTTC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026490

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026490 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G18550.1 +1 1e-139 411 227/401 (57%) alpha/beta-Hydrolases superfamily protein | chr4:10225006-10226862 REVERSE LENGTH=419

Transcript Sequence (1393 bp)

>PGSC0003DMT400026490 1393 pgsc_dm_v3.4
AAAAAATAATATATGGCTAGTATAGCTGAAAAATGGGAGGAGCTTAGTGGCAAAGAAAAT
TGGAAAGGGTTATTAAACCCTTTGGATGTTAATCTCCGAAAATACATAATTCAATATGGA
GAATTAGCTCAAGCTACTTACGACACATTCATTTCCGATAGAGCGTCAAAATATGCAGGA
AGTAGCAGATACTCGAAGGAAAACCTCTTTGCTAAAGTTGGACTAGATCCAGAAATGTAT
CACGTAACAAAATATTTTTACGCTACATCGTCGTTTCCGCTTCCCGAGGCCTTTATGGTA
AAATCATGGTCAAGGGAAGCATGGAGTAAGGAATCAAATTTTATGGGGTATGTTGCTGTG
GCTACTGATAAGGGGAAGGCTGTGTTAGGGAGAAGGGATATTGTAATTGCATGGAGAGGA
ACAATTAGAACATTAGAATGGGTTAATGATTTACAATTTTTACTAGTGCCAGCACCTAAA
GTTTTTGGTGGGGGTAATTCAATATTGCCTTTATTCAAACCTTTGGTGCATCAAGGATGG
AAAAGTATATATACATCTGATGATCCAAAATCACCATTTAATAAAGCCAGTGCAAGAGAC
CAGGTCCTTGAAGAAGTGAAAAAATTGGTTGAGAAATACAAGAATGAAGAGGTCAGCATA
ACTGTAACCGGACATAGCCTAGGTGCAGCAGTGGCAACCTTAAATGCAGTTGACATAGTT
TACAATGGATTCAACAAAACAAGCAATGGAAAGGAATTTCCAGTGACAGCTTGTGTATTT
GCAAGTCCAAACGTTGGAGATCTCAATTTCAGGGTTGCATTTTCAAAACTAAAAAATCTC
CATATTTTGAGAGTTGATAACATAGTAGATATTGTTCCAAAATATCCACCCATTGGCTAT
ATAGACGTTGGCGAAGTACTAGTAATTGACACTGCCAAATCCGATTACTTGAAGTCTCCA
GGAAACTTACAAACTTGGCATAATTTGGAGGCTTATTTACATGGAGTGGCAGGTACTCAA
GGTGTAGGAATATTAATAGGAGAATTTTTTGGTGATTTTAAATTAGAAGTGGATCGCGAT
ATAGCTCTTGTTAACAAATCAACGGATGCATTGAAGGGAGAATATGGTGTGCCTGCTAAC
TGGTGGGTTGAGAAGAACAAAGGAATGGTTCAAAAGAAAGATAAAACTTGGGTTCTCATG
GATCGTGAGGAGTATGAAATTTGAGAGAGTTCATTCAAATAAGTTCTTATTTCAATTTGG
TTTAATTTGTTTTTATATGTGGAGTTGATTTCTCTTCTATGTATGTCCTTGAAGGGAATT
TCCTTTTACGTTGTGTGTAATCCATCTATGTTGTGCTTTGTCGTCTCCGAATTGAAGTTT
GGTTTGTTATTTC