Microarray Probes on PGSC0003DMT400026363

Probe IDChipProbe Sequence
CUST_27152_PI426222305 JHI_St_60k_v1 AATGCTGTTCCAGCTATAGCTCTTCTTTCATACGGTTTCTTCCATAAAGGCCTCGTCCCT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026363

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026363 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT4G25700.1 +2 1e-109 330 194/284 (68%) beta-hydroxylase 1 | chr4:13094142-13095866 REVERSE LENGTH=310

Transcript Sequence (1345 bp)

>PGSC0003DMT400026363 1345 pgsc_dm_v3.4
TATACACTTTCCACAAGCACTCCACAAACTGAATATCCATCGTATTTGTCCACTTAACCT
GCCCTTTCAATTTCACTCATCAGCTAATTTGGATCCTCCACCGTCCATGGCGGCCGGAAT
TTCAGCCTCCGCTGGTTCCCGAACTATTTGCCTCCGTCACAACCCGTTTCGCGGTCCAAA
ATCCGCCTCAACCGCCCCGCCAGTTCTGTTCTTCTCTCCGTTAACTCGCAATTTTGGCGC
AATTTTGCTGTCTCGAAGAAAGCCGAGGTTGGCGGTTTGCTTTGTGCTGAAGAATGAGAA
ATTGAATAGTACTATCCAAAGTGAGAGTGAAGTAATACAGGATCAGATACAAGTAGAGAT
TAATGAGGAGAAGAGTTTAGCTGCCTGTTGGCTGGCGGAAAAATTGGCGAGGAAGAAATC
GGAGAGGTTTACTTATCTTGTGGCGGCTGTCATGTCTAGTTTAGGGATTACTTCTATGGC
GATTTTGTCAGTTTATTACAGATTTTCATGGCAAATGGAGGGTGGAGAAGTGCCTTTTTC
TGAAATGTTAGCTACATTCACTCTCTCGTTTGGCGCTGCCGTAGGAATGGAGTACTGGGC
GAGATGGGCTCATAGAGCACTATGGCATGCTTCTTTATGGCACATGCACGAGTCACACCA
TAGACCAAGAGAAGGACCTTTTGAGATGAACGACGTTTTCGCCATAACGAATGCTGTTCC
AGCTATAGCTCTTCTTTCATACGGTTTCTTCCATAAAGGCCTCGTCCCTGGCCTCTGTTT
TGGCGCTGGATTGGGGATCACAGTATTTGGTATGGCTTACATGTTCGTTCACGATGGACT
GGTTCATAAGAGATTCCCCGTAGGGCCTATTGCCAACGTGCCTTACTTTCGGAGGGTAGC
TGCTGCACATCAGCTTCATCACTCGGACAAATTTGATGGTGTACCATATGGCTTGTTCCT
AGGACCTAAGGAATTGGAAGAAGTAGGAGGGCTTGAAGAGTTGGAAAAGGAAGTCAACCG
AAGAATTAAAATTTCTAAGGAATTATTATGATCAAAAGATACTTCTAATAATAAAATGCA
CTTGTATTTAGGCTCTAGATCATTAATGGGAAAAAGATAGAAATATATATACATATATGA
AAATAATATAATGAAACAAGCTTTCTATGGAAATTGGAAAGTTCCTAGTCTTCTTTTTGG
TTCCTGTACGCAAAAGGTGAACAATTTGATATTCTGGTACTTGTTGACAAACCAGAAGAA
CGATAATTCAAAACAAAGAAATGTACAATTAGACTTATCGTATTGGTGGCGGTGGACAGA
TTCAAGATTTTCTCTAAGGGAGATT