Microarray Probes on PGSC0003DMT400026280

Probe IDChipProbe Sequence
CUST_27047_PI426222305 JHI_St_60k_v1 GGCTCTCAATAACAAGCCTTATCCATTTGGCTTCACCAAAGTAAACAAGAATATTGATGC

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026280

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026280 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73260.1 +1 2e-21 89 64/188 (34%) kunitz trypsin inhibitor 1 | chr1:27547410-27548057 REVERSE LENGTH=215

Transcript Sequence (672 bp)

>PGSC0003DMT400026280 672 pgsc_dm_v3.4
ATGAAGTCTATTAGTAATATTTTGAGTTTCCTCTTGGTTTCAAGTAGCCTCTCTTTGGTT
TCCTTTTCTCAATCTTTCACTTCTGATAATAATCCTGTGCTCGACATGGACGGCGAACCA
CTCAAGATAAACGAAGAGTACTCCATTCTCAGTATTCCCTATGGCGGTGGAAGCGTATAC
TTAGCTGATCTTGGAAACACCAAATGCCCAAACGGCATCGTGCAGGACAGTTCTGGTGAA
TTTGATCACAACACGCCCGTGACGTTTTTCACTATGCAACTTGGAAGTCATTATGTGTTT
GAAAACCAAGACGTTAGTATAATGTTCTCAACTACAACTTCTAATCTATGTGTTAACGAA
ACTGTTTGGAAAGCTGGTGATTACATGCTAGGGCCGGTGCATCCGCCACCTAGGTTTGTT
ATAACTGGTGGTACCTTAGGAATTCCAGGACCTAATACCTTAAAGAACTGGTTCAAAATT
GAGAAATATGAGACGGGGAGACCTCATTCTTACAAGTTAAGGTATTGTCCTAGTCAATTT
ATGTGTCCAACATGCCAATTTGATTGTGCAGATGTCGGACTATACGAAAATAAGGGATAC
GCCCGTCTGGCTCTCAATAACAAGCCTTATCCATTTGGCTTCACCAAAGTAAACAAGAAT
ATTGATGCATAG