Microarray Probes on PGSC0003DMT400026276

Probe IDChipProbe Sequence
CUST_27109_PI426222305 JHI_St_60k_v1 ATATCCTCGTCTGGCGACTGTCGATGACGATAAGGACTTTATTCCATTTGTGTTCATCAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026276

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026276 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G73325.1 +1 5e-06 46 49/181 (27%) Kunitz family trypsin and protease inhibitor protein | chr1:27567518-27568186 REVERSE LENGTH=222

Transcript Sequence (669 bp)

>PGSC0003DMT400026276 669 pgsc_dm_v3.4
ATGAAGTCGATTAATATTTTGAGTTTCCTCTTGCTTTCAAGTACCCTCTCTTTGGTTGCC
TTTGCTCGATCTTTCACTTCTGAGAATCCAATTGTCCTCCCCACAACTAGTCATGATGAT
GATAATCTTGTACTCCCTGAAGTTTATGACCAAGACGGCGATCCGCTGAGGATTGGCGAG
AGGTACATTATTAACAATCCTCTCATCGGGGCCGGAGCCGTATACTTGTACAATATTGGA
AACCTTCAATGCCCAAACGCCGTGTTGCAGCACATGTCAATTCCCCAATTTTTGGGAAAA
GGCACGCCCGTCGTATTCGTTCGTAAGTCGGAGTCGGATTATGGTGATGTGGTGCGTCAA
ATGACTGCTGTTTATATCAAGTTCTTTGTTAAAACAACAAAGTTGTGTGTTGACCAAACT
GTTTGGAAAGTTGATGATGAACAGTTGGTGGTAACTGGTGGTAAGGTAGGAAATGAAAAC
GACATCTTCAAGATTAGGAAAATTGACTTGGTGACACCAGGAAGTTCCAAAAATGTATAC
AAGTTACTGCATTGTCCCTCTCATCTTCAGTGCAAAAATATCGGCGGCAACTTTAAAAAT
GGATATCCTCGTCTGGCGACTGTCGATGACGATAAGGACTTTATTCCATTTGTGTTCATC
AAGGCGTAG