Microarray Probes on PGSC0003DMT400026261

Probe IDChipProbe Sequence
CUST_27148_PI426222305 JHI_St_60k_v1 TGGCTGTGAACCGGCCGGTTTTCAAGATTGTGTTCAGGAAGGCATAAGAAATTTATTCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026261

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026261 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17860.1 +3 5e-24 97 57/178 (32%) Kunitz family trypsin and protease inhibitor protein | chr1:6149343-6149933 FORWARD LENGTH=196

Transcript Sequence (756 bp)

>PGSC0003DMT400026261 756 pgsc_dm_v3.4
TTATAATCATACTATTGATCAATATGAAGATTTTATTACTTTCTTGCTTCCTCTATTTTA
CCTTATTTCAAATCATAAAATCCGAACCGGTTCTCGATACTAGTAATGAACAAGTCCGTC
CGGGGTACACCTACTACATATTGCCCGCTTCCGCGGGCAATGGTGGTGGCCTAACGCTAG
CCAAAGGCGAAAACGGGAGCTGCCCCCTCGACGTTTTTCAAGCACGAAATTCTCAAAGTG
TAGGCATCCCGTTGAAATTCTTGATGGTGAATTCTAGCGCGGGCTTAGTAATCGATGAAA
ATGAGGACATAAATATAAAATTCGCAGCGCGAAGGTACGTATCGATTTGTAACGTATCAA
CTGTTTGGAAAATCGAAGATGGGATTGTGACTACTGGTGGAATTAAGGGTGGATCGGAAA
ATGGCACATCTACAAGTTTATTTACGATTCAGAAATATGAAGATGCTTATGCTTTACAAT
ATTGTCCTAGAGCTACAGGTTGTTCTTTTATTTGTCCAAGATTGTTGTGTGGGTATATTG
GTATTTTACCAGCTGAAAATGGATCGAGGCATTTGGCTGTGAACCGGCCGGTTTTCAAGA
TTGTGTTCAGGAAGGCATAAGAAATTTATTCATAGTATAATAATAATAATAATAACAACA
TAGTGAAAATAAATAATGATGTTATAATTTATGGGAGGTGTTTTATATGGATTTGTCATT
TTAATCCTTTAAGAATAAATGCTTGATATTTTATTT