Microarray Probes on PGSC0003DMT400026190

Probe IDChipProbe Sequence
CUST_1545_PI426222305 JHI_St_60k_v1 CATATAATATGATCATTTACTCTCACTAACTCTAGATTCTGGATTCACCTCGTCTCTACT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400026190

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400026190 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG) Solyc02g089770.2 +3 3e-126 376 182/191 (95%) genomic_reference:SL2.50ch02 gene_region:46055433-46058696 transcript_region:SL2.50ch02:46055433..46058696+ go_terms:GO:0004022,GO:0045551 functional_description:Dihydroflavonol-4-reductase (AHRD V1 ***- B6TK03_MAIZE); contains Interpro domain(s) IPR016040 NAD(P)-binding domain
TAIR PP10 AT5G14700.1 +3 2e-39 148 72/163 (44%) NAD(P)-binding Rossmann-fold superfamily protein | chr5:4740502-4743327 REVERSE LENGTH=368

Transcript Sequence (1532 bp)

>PGSC0003DMT400026190 1532 pgsc_dm_v3.4
TTTCATATTTACCATTTTATCTACTACTTAACTAATTTATTATCTTTTGGTACATATAGA
GCTTGTATAAGTGTATATAAGTAGGCCACTCTCTAACTATGTCAACCCAGCTAAGTGGCA
GATACCCTTAAGGCTCTGAAATTTCATAATTGAGCTGCAGAAAGAGAGAGATGGATGTCG
CGATATCCTTAGAATTGGAGCCACTAAAGCAGATGAATGATCATGGAATGTTCTTTTCTA
GTGGTAATTTTATCTGCAGTTTGAATGCAAGAGACAGGAAAATTGTTTGTGTCACCAGTG
GAAACTCCTACTTTGGTTCTCACTTGATCAAGAAGCTTTTGGCATATGGTTACCTTGTTC
GAGTTATTATTCAAAATCAAGCTAATCTTGAGGACATGAAGGAGCTGATGAGGGAAGAAG
TGAAGCAACTGGAGAGTGTTGTGGTGGCAAGAATGGATGATTTAGATAGCCTCTGCAATG
CTTTTAGAGGTTGTCATGTTGTTTTCCACACATCATCTTTCGTTGATCCGCGAGGGATCT
CTGGATACACGGAACGAATGGCATTTATTGAAGCTGAAGCAGCAAAGAATGTCATAGAAG
CTTGTGGCAGGGCAGCATATGTTAAAAGATGCATTTTCACCTCTTCTCTACTTGCATGCA
TCTGGAAAAATGACCTGCCAAACCTCATAGATGAGAGCTCTTGGAGTGATGAGACATTCT
GTAGAGAACACAAGGTATACTTGTTAGCCTTCATTCTTCGTTTTCATCTAAAAGGCAGAC
GGAATACAAAGAGAATTAAAATGTATACATATAATATGATCATTTACTCTCACTAACTCT
AGATTCTGGATTCACCTCGTCTCTACTATTTAAAATCTTTTCACGGAAAAAACAGCTTTG
GCTAGCCTTGGCCAAGACCAGGGCAGAAAAGGTTGCTTGGAGGAAAGCAAGGGAGATGAA
GGTGAAACTTGTTACTTTATGTCCTGGACTTCTCATGGCACCATCTTTCCCAAACGCTCA
CCTTGAAACTTCTCTCCCGTACCTCAAAGGTGGCTATTTCATGCTAAGACAAGGAATTCT
AGCAACTGAAGATGTAAGTAAAGTGGCAGAAGCACATATTTACGTCTATGAAGATATGGA
CTATGGAGCGTGTGGAAGATATATTTGCTTTGGAAATATAGTTGGAACATTGGAAGAGGC
CATACAACTTGAAAATGGCTTGAATATATCTGGCCACTTGTCTGGGGATCAAAGCCCTCT
TGCAGTAGCAGTTGAAAATAATGAAATTCCTCCCAGAATTACTAAGTCAAAGCTCAGTAG
ATTACTATTCCATGCGTCACAACGCCTTCCTTGCAAACACTGAATAGTAATATTTGTATG
GTACTTACCTCAAAATATTATTACAAAAAAGGTAGCAATTGGAGAAGTGTAGTCAGGAAT
TTATATAAAGGTAATGTCATGATTGATAATCGAATTTGTGAGCAGAAGTTATTTTTCAGC
TCAATTTACCACAACACTATATTCAATAATTT