Microarray Probes on PGSC0003DMT400025850

Probe IDChipProbe Sequence
CUST_7469_PI426222305 JHI_St_60k_v1 CAGTGTTGTGTTGTCATCTGTACTCTTTGCCTGTTACTTGTTTTGAGTTACATGTTTAAA

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400025850

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400025850 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT2G30600.5 +2 6e-179 553 285/457 (62%) BTB/POZ domain-containing protein | chr2:13037410-13041475 FORWARD LENGTH=855

Transcript Sequence (3652 bp)

>PGSC0003DMT400025850 3652 pgsc_dm_v3.4
CTGGATATTGAATTTGACTTTTTTTGGGTGTGAATTGTGATCTGGCAATGAGGATAAGGA
TGAGGTGCAAATTGAGAACACAAGTTGTATAGGTTGATATTTTTGTTTGATTAGTTGTAT
GGTGTCTAGAGATTTCTGGGTTATTTTCAGATGGTGACCTTCCCAACTATCTCATTAGAT
TTTGAGGTTTCAGAAGTGGCACCTCATATGTTTAGAAATTGCTTTCAAGGACATCTTTTT
CCTTTTCTTTATATCTTGCTGTCAAATGTCAAAGCCCTTCCTGGATCCCATTTGATGATT
CATGCTTATCACGATTTATTGAGCAAGTTGTTTTCTTAAAATCTTTTTTGTTACTATCTG
TCAGACACTATATATATAGCAAGTTTTTCCTCAATCATTTCTCATATTGACTACTGAATC
TCTGGCTAAAAATATGGTTCATTATCAGCAGTATTCTGAAGTGAGTAAAGAGGAATTGTT
TCCTCAGAGAGAAATGATGGAGAAGAAGCAGAAGAAGTTTCTTACTGTGGCCCCGTTTGA
GTGTGCCTGGCCTAATGATCTGAGATTTAGAGAAGCAGGAAGGGGTTGTGTAGCTTTTGA
TGCTTTCGCGCATAACGATGTAACAGTTGTTTTTCGGGAGCAGGTAGGGAGTCAACACTA
TCACTACAAAAGGGATAACTGTCCACACTATACTGTAATCATTGGTAGTCATAGGAACAA
GAGATTGAAAATTGAGGTTGATGGTAAAACGGTGGTGGACGCTGCTGGTGTCGGTCTTTG
TTGTTCTTCAGCATTTCAAAGCTACTGGATTAGTATCTATGATGGATTGATTAGCATTGG
CAAGGGAAGGTATCCTTTCCAGAATCTTTGCTTTCAGTGGCTTGATTCAAATCCCAATTG
TACCGTTCAGTACATTGGTCTTAGCAGTTGGGATAAACATGTTGGCTACAGGAATGTTAA
TGTACTGCCTGCCACACCAAATCATTTATCTTTGTGGAAACATGTGGATTTTGTTGAGCA
TGATTTTGGAGAGGATGATTTAGAACAAGAGTTAGAAGATGGAATTGCTAATTATGAAAG
TTGGGGTCTTGGAAAGTTTCTTGAGAATTGGGAGTTATCGGATATGTTTTTCATTGTTGG
AAAGGAAGAAAGGGTTGTTCCAGCTCATAAGCTAGTTTTAGAGGCATGTGGGGATTTTTG
TCTTAGTTCATCAGTTGAAGAAGCTGTTCACCTGCCAGACATAAGTTATTCTGTTCTTCA
TGCACTTCTTCAGTACATCTACACTGGACATACTCAGATTTTGGAGTCTGATCTCTGCTC
ATTGAAGTCTTTGAGCTTACAATACAAAGTGATGTCATTGGTGAGGCAATGTGAAGAGAT
CCTTGAGCGAATTATGTCTAATAAGCAACTCGTTGACTCAACTCAGCTTGTAGACATATT
TTATCCAAGCTGGCTCCAATGCAGCAAAACTTTTCCTTATGGGTTGCCAATTGATAGAGA
AAGGCTTGAACGGTTCCTCTCGACTGGAGAGTATAGTGATCTAGACCTTTATGTTGGAGT
TCATGATATTGTTTTGCGATCACATAAAGTGATCCTTGGGTCATGGAGTACTCCTTTCAC
AAAGATGTTTACAAATGGAATGAGGGAGAGTGTTTCTTCAGTGGTCTGCTTAAAAGATGT
TCCTCTTGAAGCATTCAAGATTATGCTAGAATTCATGTACAGTGGAGAACTTAATAAAGA
AGCTACTGAGGGAATCAATACCTTGTTACTTCAGCTACTTTTACTAGCCGATGAGTTTGG
GGTAACACTTCTTCATCAGGAGTGCTGCAAAATACTTCTGGAGTGCCTCTCAGAGGTAAT
CTTGTGATTCTGACCTCTTTCCAGACACCTCTTTTGTTGCTAAACCTGTATCTGTCGTGT
GCATGTTGAAAGTGCTAAATGTCAGACTACAATTAAAAGAGTGGAGAAGTGATGCAGTTC
GAAGTTGTGAGCGTGAGCAGAGCCATTTTATGAAAATGAGATACAAATATTAATACCTTT
CATCTATACATTATATGCAGGGATGGAGTTCTCCTATTGGAAGAAGGTTCAAGAATTTTT
TCTATTATGCCAAGTTTAGTGGACGAGGAAGAAGACACTTTGGAAAAGTCTTTGGGTCGT
GATTGTGACACTAACTATTGATCTTTGTTGCAGGACTCAGTATGCCCAATTCTTCAAGTG
ATATCATCTATTCCCTCGTGTAAACTCATCGAAGAAACCTGTGAGAGGATATTCTCCATG
CACTTTGATTATTGTACAACTGCAAGCATTGACTTTGTCATGTTAGATGAATCAAGTTTT
AGCAATATCCTTCAGCATACAGATTTGACAGTGACATCTGAAGAGAGAGTTCTCAATGCC
ATCTTGCTTTGGTGCTTACAAGCAAGAGAACTGTGTGGATGGGAAGCAGTAAACGAATTG
ATGGTAAATTCAACACCTGAGATGCTTTTTGGAGAGAGACTTGAGTCTCTAAATGAATTT
CTGCATCTTGTGCGGTTCCCTTTACTTTCACCTGATTTGCTGAATAAGTTTGAACAGAGT
AGCCTTAGCCAGCAAATTCCCACTTTTGACCATCTGGTTAAAGAGGCATTAAGATTTCTG
GAATTTGAGGTCACCGATTTTCAAGGAAGCCAGAGGTGAGTATACTTAAAAGGTTTTATT
CAAACCACCCTGTGACCATAGTTAGATATGGTATTGCAATATCCTCGAGGGAATGACCTA
GTAAATTAAGCGTCTAATAAATGAAATAACTATTTGTCGGTCTGTATGCATGCTAAACCT
GTCTTTCAATTGGAGCATGACTATACAAAATGTCTAAAAGCTGATGAAGTTCTCTGTGTC
TTATGATAATAGATTTCAGCATAGAAAATCAAGTTTTAAGGAGCTGCTCTACATATGCGA
TGGAGATAGCAACGGGGTCCTTTATTTTGCTGGCACATCATATGGGAAACACCAGTGGGT
GAATCCTGTTTTGTCCAAGAGAGTAATTATCACGGCTAGTAGCCCCATTTCAAGATGCAC
TGATCCCAAGGTGTTAGTATCGAGGAACTTCCAGGGTACATCTGTTGCTGGACCTCAGAT
GGAGGGCGGAAGAAACGCTTCGTGGTGGATGGTTGATATTGGTCCGGATCACCAGCTCAT
GTGTAACTACTACACATTAAGACAGGACGGATCAAGAGCATTTATCAGACGTTGGAACTT
TCAGGGCTCTTTGGATGGGAAAAATTGGACAAACCTGAGAGTACATGAGAATGATCAAAC
TATTTGCAAGCCAGGTCAATTTGCATCATGGCCAATTACTGGTTCAAATGCATTACTTCC
TTTCAGATTCTTTCGAGTTCTCATGACCGGTCCTACTACAGACGATACTAACCCGTGGAA
CTGTTGCATCTGCTTCTTAGAACTCTATGGCTATTTTCGTTAGCTTGGCGTCGGTTTGAA
CATAGTTTTTGTTTTCAAACTCTTCATTTACAGTCAAAATGTTGTATGGTTTTTGTATTC
CTCAATGATGTTTACAGTGTTGTGTTGTCATCTGTACTCTTTGCCTGTTACTTGTTTTGA
GTTACATGTTTAAAAAAGTGTCTTTTTGCCATATTTTGTTCTCTTATTATTA